| [ Index ] |
PHP Cross Reference of Unnamed Project |
[Summary view] [Print] [Text view]
1 =head1 NAME 2 3 perlretut - Perl regular expressions tutorial 4 5 =head1 DESCRIPTION 6 7 This page provides a basic tutorial on understanding, creating and 8 using regular expressions in Perl. It serves as a complement to the 9 reference page on regular expressions L<perlre>. Regular expressions 10 are an integral part of the C<m//>, C<s///>, C<qr//> and C<split> 11 operators and so this tutorial also overlaps with 12 L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>. 13 14 Perl is widely renowned for excellence in text processing, and regular 15 expressions are one of the big factors behind this fame. Perl regular 16 expressions display an efficiency and flexibility unknown in most 17 other computer languages. Mastering even the basics of regular 18 expressions will allow you to manipulate text with surprising ease. 19 20 What is a regular expression? A regular expression is simply a string 21 that describes a pattern. Patterns are in common use these days; 22 examples are the patterns typed into a search engine to find web pages 23 and the patterns used to list files in a directory, e.g., C<ls *.txt> 24 or C<dir *.*>. In Perl, the patterns described by regular expressions 25 are used to search strings, extract desired parts of strings, and to 26 do search and replace operations. 27 28 Regular expressions have the undeserved reputation of being abstract 29 and difficult to understand. Regular expressions are constructed using 30 simple concepts like conditionals and loops and are no more difficult 31 to understand than the corresponding C<if> conditionals and C<while> 32 loops in the Perl language itself. In fact, the main challenge in 33 learning regular expressions is just getting used to the terse 34 notation used to express these concepts. 35 36 This tutorial flattens the learning curve by discussing regular 37 expression concepts, along with their notation, one at a time and with 38 many examples. The first part of the tutorial will progress from the 39 simplest word searches to the basic regular expression concepts. If 40 you master the first part, you will have all the tools needed to solve 41 about 98% of your needs. The second part of the tutorial is for those 42 comfortable with the basics and hungry for more power tools. It 43 discusses the more advanced regular expression operators and 44 introduces the latest cutting edge innovations in 5.6.0. 45 46 A note: to save time, 'regular expression' is often abbreviated as 47 regexp or regex. Regexp is a more natural abbreviation than regex, but 48 is harder to pronounce. The Perl pod documentation is evenly split on 49 regexp vs regex; in Perl, there is more than one way to abbreviate it. 50 We'll use regexp in this tutorial. 51 52 =head1 Part 1: The basics 53 54 =head2 Simple word matching 55 56 The simplest regexp is simply a word, or more generally, a string of 57 characters. A regexp consisting of a word matches any string that 58 contains that word: 59 60 "Hello World" =~ /World/; # matches 61 62 What is this Perl statement all about? C<"Hello World"> is a simple 63 double quoted string. C<World> is the regular expression and the 64 C<//> enclosing C</World/> tells Perl to search a string for a match. 65 The operator C<=~> associates the string with the regexp match and 66 produces a true value if the regexp matched, or false if the regexp 67 did not match. In our case, C<World> matches the second word in 68 C<"Hello World">, so the expression is true. Expressions like this 69 are useful in conditionals: 70 71 if ("Hello World" =~ /World/) { 72 print "It matches\n"; 73 } 74 else { 75 print "It doesn't match\n"; 76 } 77 78 There are useful variations on this theme. The sense of the match can 79 be reversed by using the C<!~> operator: 80 81 if ("Hello World" !~ /World/) { 82 print "It doesn't match\n"; 83 } 84 else { 85 print "It matches\n"; 86 } 87 88 The literal string in the regexp can be replaced by a variable: 89 90 $greeting = "World"; 91 if ("Hello World" =~ /$greeting/) { 92 print "It matches\n"; 93 } 94 else { 95 print "It doesn't match\n"; 96 } 97 98 If you're matching against the special default variable C<$_>, the 99 C<$_ =~> part can be omitted: 100 101 $_ = "Hello World"; 102 if (/World/) { 103 print "It matches\n"; 104 } 105 else { 106 print "It doesn't match\n"; 107 } 108 109 And finally, the C<//> default delimiters for a match can be changed 110 to arbitrary delimiters by putting an C<'m'> out front: 111 112 "Hello World" =~ m!World!; # matches, delimited by '!' 113 "Hello World" =~ m{World}; # matches, note the matching '{}' 114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin', 115 # '/' becomes an ordinary char 116 117 C</World/>, C<m!World!>, and C<m{World}> all represent the 118 same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward 119 slash C<'/'> becomes an ordinary character and can be used in this regexp 120 without trouble. 121 122 Let's consider how different regexps would match C<"Hello World">: 123 124 "Hello World" =~ /world/; # doesn't match 125 "Hello World" =~ /o W/; # matches 126 "Hello World" =~ /oW/; # doesn't match 127 "Hello World" =~ /World /; # doesn't match 128 129 The first regexp C<world> doesn't match because regexps are 130 case-sensitive. The second regexp matches because the substring 131 S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space 132 character ' ' is treated like any other character in a regexp and is 133 needed to match in this case. The lack of a space character is the 134 reason the third regexp C<'oW'> doesn't match. The fourth regexp 135 C<'World '> doesn't match because there is a space at the end of the 136 regexp, but not at the end of the string. The lesson here is that 137 regexps must match a part of the string I<exactly> in order for the 138 statement to be true. 139 140 If a regexp matches in more than one place in the string, Perl will 141 always match at the earliest possible point in the string: 142 143 "Hello World" =~ /o/; # matches 'o' in 'Hello' 144 "That hat is red" =~ /hat/; # matches 'hat' in 'That' 145 146 With respect to character matching, there are a few more points you 147 need to know about. First of all, not all characters can be used 'as 148 is' in a match. Some characters, called I<metacharacters>, are reserved 149 for use in regexp notation. The metacharacters are 150 151 {}[]()^$.|*+?\ 152 153 The significance of each of these will be explained 154 in the rest of the tutorial, but for now, it is important only to know 155 that a metacharacter can be matched by putting a backslash before it: 156 157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter 158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary + 159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error! 160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches 161 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches 162 163 In the last regexp, the forward slash C<'/'> is also backslashed, 164 because it is used to delimit the regexp. This can lead to LTS 165 (leaning toothpick syndrome), however, and it is often more readable 166 to change delimiters. 167 168 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read 169 170 The backslash character C<'\'> is a metacharacter itself and needs to 171 be backslashed: 172 173 'C:\WIN32' =~ /C:\\WIN/; # matches 174 175 In addition to the metacharacters, there are some ASCII characters 176 which don't have printable character equivalents and are instead 177 represented by I<escape sequences>. Common examples are C<\t> for a 178 tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a 179 bell. If your string is better thought of as a sequence of arbitrary 180 bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape 181 sequence, e.g., C<\x1B> may be a more natural representation for your 182 bytes. Here are some examples of escapes: 183 184 "1000\t2000" =~ m(0\t2) # matches 185 "1000\n2000" =~ /0\n20/ # matches 186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000" 187 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat 188 189 If you've been around Perl a while, all this talk of escape sequences 190 may seem familiar. Similar escape sequences are used in double-quoted 191 strings and in fact the regexps in Perl are mostly treated as 192 double-quoted strings. This means that variables can be used in 193 regexps as well. Just like double-quoted strings, the values of the 194 variables in the regexp will be substituted in before the regexp is 195 evaluated for matching purposes. So we have: 196 197 $foo = 'house'; 198 'housecat' =~ /$foo/; # matches 199 'cathouse' =~ /cat$foo/; # matches 200 'housecat' =~ /$foo}cat/; # matches 201 202 So far, so good. With the knowledge above you can already perform 203 searches with just about any literal string regexp you can dream up. 204 Here is a I<very simple> emulation of the Unix grep program: 205 206 % cat > simple_grep 207 #!/usr/bin/perl 208 $regexp = shift; 209 while (<>) { 210 print if /$regexp/; 211 } 212 ^D 213 214 % chmod +x simple_grep 215 216 % simple_grep abba /usr/dict/words 217 Babbage 218 cabbage 219 cabbages 220 sabbath 221 Sabbathize 222 Sabbathizes 223 sabbatical 224 scabbard 225 scabbards 226 227 This program is easy to understand. C<#!/usr/bin/perl> is the standard 228 way to invoke a perl program from the shell. 229 S<C<$regexp = shift;>> saves the first command line argument as the 230 regexp to be used, leaving the rest of the command line arguments to 231 be treated as files. S<C<< while (<>) >>> loops over all the lines in 232 all the files. For each line, S<C<print if /$regexp/;>> prints the 233 line if the regexp matches the line. In this line, both C<print> and 234 C</$regexp/> use the default variable C<$_> implicitly. 235 236 With all of the regexps above, if the regexp matched anywhere in the 237 string, it was considered a match. Sometimes, however, we'd like to 238 specify I<where> in the string the regexp should try to match. To do 239 this, we would use the I<anchor> metacharacters C<^> and C<$>. The 240 anchor C<^> means match at the beginning of the string and the anchor 241 C<$> means match at the end of the string, or before a newline at the 242 end of the string. Here is how they are used: 243 244 "housekeeper" =~ /keeper/; # matches 245 "housekeeper" =~ /^keeper/; # doesn't match 246 "housekeeper" =~ /keeper$/; # matches 247 "housekeeper\n" =~ /keeper$/; # matches 248 249 The second regexp doesn't match because C<^> constrains C<keeper> to 250 match only at the beginning of the string, but C<"housekeeper"> has 251 keeper starting in the middle. The third regexp does match, since the 252 C<$> constrains C<keeper> to match only at the end of the string. 253 254 When both C<^> and C<$> are used at the same time, the regexp has to 255 match both the beginning and the end of the string, i.e., the regexp 256 matches the whole string. Consider 257 258 "keeper" =~ /^keep$/; # doesn't match 259 "keeper" =~ /^keeper$/; # matches 260 "" =~ /^$/; # ^$ matches an empty string 261 262 The first regexp doesn't match because the string has more to it than 263 C<keep>. Since the second regexp is exactly the string, it 264 matches. Using both C<^> and C<$> in a regexp forces the complete 265 string to match, so it gives you complete control over which strings 266 match and which don't. Suppose you are looking for a fellow named 267 bert, off in a string by himself: 268 269 "dogbert" =~ /bert/; # matches, but not what you want 270 271 "dilbert" =~ /^bert/; # doesn't match, but .. 272 "bertram" =~ /^bert/; # matches, so still not good enough 273 274 "bertram" =~ /^bert$/; # doesn't match, good 275 "dilbert" =~ /^bert$/; # doesn't match, good 276 "bert" =~ /^bert$/; # matches, perfect 277 278 Of course, in the case of a literal string, one could just as easily 279 use the string comparison S<C<$string eq 'bert'>> and it would be 280 more efficient. The C<^...$> regexp really becomes useful when we 281 add in the more powerful regexp tools below. 282 283 =head2 Using character classes 284 285 Although one can already do quite a lot with the literal string 286 regexps above, we've only scratched the surface of regular expression 287 technology. In this and subsequent sections we will introduce regexp 288 concepts (and associated metacharacter notations) that will allow a 289 regexp to not just represent a single character sequence, but a I<whole 290 class> of them. 291 292 One such concept is that of a I<character class>. A character class 293 allows a set of possible characters, rather than just a single 294 character, to match at a particular point in a regexp. Character 295 classes are denoted by brackets C<[...]>, with the set of characters 296 to be possibly matched inside. Here are some examples: 297 298 /cat/; # matches 'cat' 299 /[bcr]at/; # matches 'bat, 'cat', or 'rat' 300 /item[0123456789]/; # matches 'item0' or ... or 'item9' 301 "abc" =~ /[cab]/; # matches 'a' 302 303 In the last statement, even though C<'c'> is the first character in 304 the class, C<'a'> matches because the first character position in the 305 string is the earliest point at which the regexp can match. 306 307 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way 308 # 'yes', 'Yes', 'YES', etc. 309 310 This regexp displays a common task: perform a case-insensitive 311 match. Perl provides a way of avoiding all those brackets by simply 312 appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;> 313 can be rewritten as C</yes/i;>. The C<'i'> stands for 314 case-insensitive and is an example of a I<modifier> of the matching 315 operation. We will meet other modifiers later in the tutorial. 316 317 We saw in the section above that there were ordinary characters, which 318 represented themselves, and special characters, which needed a 319 backslash C<\> to represent themselves. The same is true in a 320 character class, but the sets of ordinary and special characters 321 inside a character class are different than those outside a character 322 class. The special characters for a character class are C<-]\^$> (and 323 the pattern delimiter, whatever it is). 324 C<]> is special because it denotes the end of a character class. C<$> is 325 special because it denotes a scalar variable. C<\> is special because 326 it is used in escape sequences, just like above. Here is how the 327 special characters C<]$\> are handled: 328 329 /[\]c]def/; # matches ']def' or 'cdef' 330 $x = 'bcr'; 331 /[$x]at/; # matches 'bat', 'cat', or 'rat' 332 /[\$x]at/; # matches '$at' or 'xat' 333 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat' 334 335 The last two are a little tricky. In C<[\$x]>, the backslash protects 336 the dollar sign, so the character class has two members C<$> and C<x>. 337 In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a 338 variable and substituted in double quote fashion. 339 340 The special character C<'-'> acts as a range operator within character 341 classes, so that a contiguous set of characters can be written as a 342 range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]> 343 become the svelte C<[0-9]> and C<[a-z]>. Some examples are 344 345 /item[0-9]/; # matches 'item0' or ... or 'item9' 346 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa', 347 # 'baa', 'xaa', 'yaa', or 'zaa' 348 /[0-9a-fA-F]/; # matches a hexadecimal digit 349 /[0-9a-zA-Z_]/; # matches a "word" character, 350 # like those in a Perl variable name 351 352 If C<'-'> is the first or last character in a character class, it is 353 treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are 354 all equivalent. 355 356 The special character C<^> in the first position of a character class 357 denotes a I<negated character class>, which matches any character but 358 those in the brackets. Both C<[...]> and C<[^...]> must match a 359 character, or the match fails. Then 360 361 /[^a]at/; # doesn't match 'aat' or 'at', but matches 362 # all other 'bat', 'cat, '0at', '%at', etc. 363 /[^0-9]/; # matches a non-numeric character 364 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary 365 366 Now, even C<[0-9]> can be a bother to write multiple times, so in the 367 interest of saving keystrokes and making regexps more readable, Perl 368 has several abbreviations for common character classes, as shown below. 369 Since the introduction of Unicode, these character classes match more 370 than just a few characters in the ISO 8859-1 range. 371 372 =over 4 373 374 =item * 375 376 \d matches a digit, not just [0-9] but also digits from non-roman scripts 377 378 =item * 379 380 \s matches a whitespace character, the set [\ \t\r\n\f] and others 381 382 =item * 383 384 \w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_] 385 but also digits and characters from non-roman scripts 386 387 =item * 388 389 \D is a negated \d; it represents any other character than a digit, or [^\d] 390 391 =item * 392 393 \S is a negated \s; it represents any non-whitespace character [^\s] 394 395 =item * 396 397 \W is a negated \w; it represents any non-word character [^\w] 398 399 =item * 400 401 The period '.' matches any character but "\n" (unless the modifier C<//s> is 402 in effect, as explained below). 403 404 =back 405 406 The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside 407 of character classes. Here are some in use: 408 409 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format 410 /[\d\s]/; # matches any digit or whitespace character 411 /\w\W\w/; # matches a word char, followed by a 412 # non-word char, followed by a word char 413 /..rt/; # matches any two chars, followed by 'rt' 414 /end\./; # matches 'end.' 415 /end[.]/; # same thing, matches 'end.' 416 417 Because a period is a metacharacter, it needs to be escaped to match 418 as an ordinary period. Because, for example, C<\d> and C<\w> are sets 419 of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in 420 fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as 421 C<[\W]>. Think DeMorgan's laws. 422 423 An anchor useful in basic regexps is the I<word anchor> 424 C<\b>. This matches a boundary between a word character and a non-word 425 character C<\w\W> or C<\W\w>: 426 427 $x = "Housecat catenates house and cat"; 428 $x =~ /cat/; # matches cat in 'housecat' 429 $x =~ /\bcat/; # matches cat in 'catenates' 430 $x =~ /cat\b/; # matches cat in 'housecat' 431 $x =~ /\bcat\b/; # matches 'cat' at end of string 432 433 Note in the last example, the end of the string is considered a word 434 boundary. 435 436 You might wonder why C<'.'> matches everything but C<"\n"> - why not 437 every character? The reason is that often one is matching against 438 lines and would like to ignore the newline characters. For instance, 439 while the string C<"\n"> represents one line, we would like to think 440 of it as empty. Then 441 442 "" =~ /^$/; # matches 443 "\n" =~ /^$/; # matches, $ anchors before "\n" 444 445 "" =~ /./; # doesn't match; it needs a char 446 "" =~ /^.$/; # doesn't match; it needs a char 447 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n" 448 "a" =~ /^.$/; # matches 449 "a\n" =~ /^.$/; # matches, $ anchors before "\n" 450 451 This behavior is convenient, because we usually want to ignore 452 newlines when we count and match characters in a line. Sometimes, 453 however, we want to keep track of newlines. We might even want C<^> 454 and C<$> to anchor at the beginning and end of lines within the 455 string, rather than just the beginning and end of the string. Perl 456 allows us to choose between ignoring and paying attention to newlines 457 by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for 458 single line and multi-line and they determine whether a string is to 459 be treated as one continuous string, or as a set of lines. The two 460 modifiers affect two aspects of how the regexp is interpreted: 1) how 461 the C<'.'> character class is defined, and 2) where the anchors C<^> 462 and C<$> are able to match. Here are the four possible combinations: 463 464 =over 4 465 466 =item * 467 468 no modifiers (//): Default behavior. C<'.'> matches any character 469 except C<"\n">. C<^> matches only at the beginning of the string and 470 C<$> matches only at the end or before a newline at the end. 471 472 =item * 473 474 s modifier (//s): Treat string as a single long line. C<'.'> matches 475 any character, even C<"\n">. C<^> matches only at the beginning of 476 the string and C<$> matches only at the end or before a newline at the 477 end. 478 479 =item * 480 481 m modifier (//m): Treat string as a set of multiple lines. C<'.'> 482 matches any character except C<"\n">. C<^> and C<$> are able to match 483 at the start or end of I<any> line within the string. 484 485 =item * 486 487 both s and m modifiers (//sm): Treat string as a single long line, but 488 detect multiple lines. C<'.'> matches any character, even 489 C<"\n">. C<^> and C<$>, however, are able to match at the start or end 490 of I<any> line within the string. 491 492 =back 493 494 Here are examples of C<//s> and C<//m> in action: 495 496 $x = "There once was a girl\nWho programmed in Perl\n"; 497 498 $x =~ /^Who/; # doesn't match, "Who" not at start of string 499 $x =~ /^Who/s; # doesn't match, "Who" not at start of string 500 $x =~ /^Who/m; # matches, "Who" at start of second line 501 $x =~ /^Who/sm; # matches, "Who" at start of second line 502 503 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n" 504 $x =~ /girl.Who/s; # matches, "." matches "\n" 505 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n" 506 $x =~ /girl.Who/sm; # matches, "." matches "\n" 507 508 Most of the time, the default behavior is what is wanted, but C<//s> and 509 C<//m> are occasionally very useful. If C<//m> is being used, the start 510 of the string can still be matched with C<\A> and the end of the string 511 can still be matched with the anchors C<\Z> (matches both the end and 512 the newline before, like C<$>), and C<\z> (matches only the end): 513 514 $x =~ /^Who/m; # matches, "Who" at start of second line 515 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string 516 517 $x =~ /girl$/m; # matches, "girl" at end of first line 518 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string 519 520 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end 521 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string 522 523 We now know how to create choices among classes of characters in a 524 regexp. What about choices among words or character strings? Such 525 choices are described in the next section. 526 527 =head2 Matching this or that 528 529 Sometimes we would like our regexp to be able to match different 530 possible words or character strings. This is accomplished by using 531 the I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we 532 form the regexp C<dog|cat>. As before, Perl will try to match the 533 regexp at the earliest possible point in the string. At each 534 character position, Perl will first try to match the first 535 alternative, C<dog>. If C<dog> doesn't match, Perl will then try the 536 next alternative, C<cat>. If C<cat> doesn't match either, then the 537 match fails and Perl moves to the next position in the string. Some 538 examples: 539 540 "cats and dogs" =~ /cat|dog|bird/; # matches "cat" 541 "cats and dogs" =~ /dog|cat|bird/; # matches "cat" 542 543 Even though C<dog> is the first alternative in the second regexp, 544 C<cat> is able to match earlier in the string. 545 546 "cats" =~ /c|ca|cat|cats/; # matches "c" 547 "cats" =~ /cats|cat|ca|c/; # matches "cats" 548 549 Here, all the alternatives match at the first string position, so the 550 first alternative is the one that matches. If some of the 551 alternatives are truncations of the others, put the longest ones first 552 to give them a chance to match. 553 554 "cab" =~ /a|b|c/ # matches "c" 555 # /a|b|c/ == /[abc]/ 556 557 The last example points out that character classes are like 558 alternations of characters. At a given character position, the first 559 alternative that allows the regexp match to succeed will be the one 560 that matches. 561 562 =head2 Grouping things and hierarchical matching 563 564 Alternation allows a regexp to choose among alternatives, but by 565 itself it is unsatisfying. The reason is that each alternative is a whole 566 regexp, but sometime we want alternatives for just part of a 567 regexp. For instance, suppose we want to search for housecats or 568 housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is 569 inefficient because we had to type C<house> twice. It would be nice to 570 have parts of the regexp be constant, like C<house>, and some 571 parts have alternatives, like C<cat|keeper>. 572 573 The I<grouping> metacharacters C<()> solve this problem. Grouping 574 allows parts of a regexp to be treated as a single unit. Parts of a 575 regexp are grouped by enclosing them in parentheses. Thus we could solve 576 the C<housecat|housekeeper> by forming the regexp as 577 C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match 578 C<house> followed by either C<cat> or C<keeper>. Some more examples 579 are 580 581 /(a|b)b/; # matches 'ab' or 'bb' 582 /(ac|b)b/; # matches 'acb' or 'bb' 583 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere 584 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd' 585 586 /house(cat|)/; # matches either 'housecat' or 'house' 587 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or 588 # 'house'. Note groups can be nested. 589 590 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx 591 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d', 592 # because '20\d\d' can't match 593 594 Alternations behave the same way in groups as out of them: at a given 595 string position, the leftmost alternative that allows the regexp to 596 match is taken. So in the last example at the first string position, 597 C<"20"> matches the second alternative, but there is nothing left over 598 to match the next two digits C<\d\d>. So Perl moves on to the next 599 alternative, which is the null alternative and that works, since 600 C<"20"> is two digits. 601 602 The process of trying one alternative, seeing if it matches, and 603 moving on to the next alternative, while going back in the string 604 from where the previous alternative was tried, if it doesn't, is called 605 I<backtracking>. The term 'backtracking' comes from the idea that 606 matching a regexp is like a walk in the woods. Successfully matching 607 a regexp is like arriving at a destination. There are many possible 608 trailheads, one for each string position, and each one is tried in 609 order, left to right. From each trailhead there may be many paths, 610 some of which get you there, and some which are dead ends. When you 611 walk along a trail and hit a dead end, you have to backtrack along the 612 trail to an earlier point to try another trail. If you hit your 613 destination, you stop immediately and forget about trying all the 614 other trails. You are persistent, and only if you have tried all the 615 trails from all the trailheads and not arrived at your destination, do 616 you declare failure. To be concrete, here is a step-by-step analysis 617 of what Perl does when it tries to match the regexp 618 619 "abcde" =~ /(abd|abc)(df|d|de)/; 620 621 =over 4 622 623 =item 0 624 625 Start with the first letter in the string 'a'. 626 627 =item 1 628 629 Try the first alternative in the first group 'abd'. 630 631 =item 2 632 633 Match 'a' followed by 'b'. So far so good. 634 635 =item 3 636 637 'd' in the regexp doesn't match 'c' in the string - a dead 638 end. So backtrack two characters and pick the second alternative in 639 the first group 'abc'. 640 641 =item 4 642 643 Match 'a' followed by 'b' followed by 'c'. We are on a roll 644 and have satisfied the first group. Set $1 to 'abc'. 645 646 =item 5 647 648 Move on to the second group and pick the first alternative 649 'df'. 650 651 =item 6 652 653 Match the 'd'. 654 655 =item 7 656 657 'f' in the regexp doesn't match 'e' in the string, so a dead 658 end. Backtrack one character and pick the second alternative in the 659 second group 'd'. 660 661 =item 8 662 663 'd' matches. The second grouping is satisfied, so set $2 to 664 'd'. 665 666 =item 9 667 668 We are at the end of the regexp, so we are done! We have 669 matched 'abcd' out of the string "abcde". 670 671 =back 672 673 There are a couple of things to note about this analysis. First, the 674 third alternative in the second group 'de' also allows a match, but we 675 stopped before we got to it - at a given character position, leftmost 676 wins. Second, we were able to get a match at the first character 677 position of the string 'a'. If there were no matches at the first 678 position, Perl would move to the second character position 'b' and 679 attempt the match all over again. Only when all possible paths at all 680 possible character positions have been exhausted does Perl give 681 up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false. 682 683 Even with all this work, regexp matching happens remarkably fast. To 684 speed things up, Perl compiles the regexp into a compact sequence of 685 opcodes that can often fit inside a processor cache. When the code is 686 executed, these opcodes can then run at full throttle and search very 687 quickly. 688 689 =head2 Extracting matches 690 691 The grouping metacharacters C<()> also serve another completely 692 different function: they allow the extraction of the parts of a string 693 that matched. This is very useful to find out what matched and for 694 text processing in general. For each grouping, the part that matched 695 inside goes into the special variables C<$1>, C<$2>, etc. They can be 696 used just as ordinary variables: 697 698 # extract hours, minutes, seconds 699 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format 700 $hours = $1; 701 $minutes = $2; 702 $seconds = $3; 703 } 704 705 Now, we know that in scalar context, 706 S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false 707 value. In list context, however, it returns the list of matched values 708 C<($1,$2,$3)>. So we could write the code more compactly as 709 710 # extract hours, minutes, seconds 711 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/); 712 713 If the groupings in a regexp are nested, C<$1> gets the group with the 714 leftmost opening parenthesis, C<$2> the next opening parenthesis, 715 etc. Here is a regexp with nested groups: 716 717 /(ab(cd|ef)((gi)|j))/; 718 1 2 34 719 720 If this regexp matches, C<$1> contains a string starting with 721 C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either 722 C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>, 723 or it remains undefined. 724 725 For convenience, Perl sets C<$+> to the string held by the highest numbered 726 C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the 727 value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>, 728 C<$2>,... associated with the rightmost closing parenthesis used in the 729 match). 730 731 732 =head2 Backreferences 733 734 Closely associated with the matching variables C<$1>, C<$2>, ... are 735 the I<backreferences> C<\1>, C<\2>,... Backreferences are simply 736 matching variables that can be used I<inside> a regexp. This is a 737 really nice feature -- what matches later in a regexp is made to depend on 738 what matched earlier in the regexp. Suppose we wanted to look 739 for doubled words in a text, like 'the the'. The following regexp finds 740 all 3-letter doubles with a space in between: 741 742 /\b(\w\w\w)\s\1\b/; 743 744 The grouping assigns a value to \1, so that the same 3 letter sequence 745 is used for both parts. 746 747 A similar task is to find words consisting of two identical parts: 748 749 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words 750 beriberi 751 booboo 752 coco 753 mama 754 murmur 755 papa 756 757 The regexp has a single grouping which considers 4-letter 758 combinations, then 3-letter combinations, etc., and uses C<\1> to look for 759 a repeat. Although C<$1> and C<\1> represent the same thing, care should be 760 taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp 761 and backreferences C<\1>, C<\2>,... only I<inside> a regexp; not doing 762 so may lead to surprising and unsatisfactory results. 763 764 765 =head2 Relative backreferences 766 767 Counting the opening parentheses to get the correct number for a 768 backreference is errorprone as soon as there is more than one 769 capturing group. A more convenient technique became available 770 with Perl 5.10: relative backreferences. To refer to the immediately 771 preceding capture group one now may write C<\g{-1}>, the next but 772 last is available via C<\g{-2}>, and so on. 773 774 Another good reason in addition to readability and maintainability 775 for using relative backreferences is illustrated by the following example, 776 where a simple pattern for matching peculiar strings is used: 777 778 $a99a = '([a-z])(\d)\2\1'; # matches a11a, g22g, x33x, etc. 779 780 Now that we have this pattern stored as a handy string, we might feel 781 tempted to use it as a part of some other pattern: 782 783 $line = "code=e99e"; 784 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior! 785 print "$1 is valid\n"; 786 } else { 787 print "bad line: '$line'\n"; 788 } 789 790 But this doesn't match -- at least not the way one might expect. Only 791 after inserting the interpolated C<$a99a> and looking at the resulting 792 full text of the regexp is it obvious that the backreferences have 793 backfired -- the subexpression C<(\w+)> has snatched number 1 and 794 demoted the groups in C<$a99a> by one rank. This can be avoided by 795 using relative backreferences: 796 797 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated 798 799 800 =head2 Named backreferences 801 802 Perl 5.10 also introduced named capture buffers and named backreferences. 803 To attach a name to a capturing group, you write either 804 C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may 805 then be written as C<\g{name}>. It is permissible to attach the 806 same name to more than one group, but then only the leftmost one of the 807 eponymous set can be referenced. Outside of the pattern a named 808 capture buffer is accessible through the C<%+> hash. 809 810 Assuming that we have to match calendar dates which may be given in one 811 of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write 812 three suitable patterns where we use 'd', 'm' and 'y' respectively as the 813 names of the buffers capturing the pertaining components of a date. The 814 matching operation combines the three patterns as alternatives: 815 816 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)'; 817 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)'; 818 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)'; 819 for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){ 820 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){ 821 print "day=$+{d} month=$+{m} year=$+{y}\n"; 822 } 823 } 824 825 If any of the alternatives matches, the hash C<%+> is bound to contain the 826 three key-value pairs. 827 828 829 =head2 Alternative capture group numbering 830 831 Yet another capturing group numbering technique (also as from Perl 5.10) 832 deals with the problem of referring to groups within a set of alternatives. 833 Consider a pattern for matching a time of the day, civil or military style: 834 835 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){ 836 # process hour and minute 837 } 838 839 Processing the results requires an additional if statement to determine 840 whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would 841 be easier if we could use buffer numbers 1 and 2 in second alternative as 842 well, and this is exactly what the parenthesized construct C<(?|...)>, 843 set around an alternative achieves. Here is an extended version of the 844 previous pattern: 845 846 if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){ 847 print "hour=$1 minute=$2 zone=$3\n"; 848 } 849 850 Within the alternative numbering group, buffer numbers start at the same 851 position for each alternative. After the group, numbering continues 852 with one higher than the maximum reached across all the alternatives. 853 854 =head2 Position information 855 856 In addition to what was matched, Perl (since 5.6.0) also provides the 857 positions of what was matched as contents of the C<@-> and C<@+> 858 arrays. C<$-[0]> is the position of the start of the entire match and 859 C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the 860 position of the start of the C<$n> match and C<$+[n]> is the position 861 of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then 862 this code 863 864 $x = "Mmm...donut, thought Homer"; 865 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches 866 foreach $expr (1..$#-) { 867 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n"; 868 } 869 870 prints 871 872 Match 1: 'Mmm' at position (0,3) 873 Match 2: 'donut' at position (6,11) 874 875 Even if there are no groupings in a regexp, it is still possible to 876 find out what exactly matched in a string. If you use them, Perl 877 will set C<$`> to the part of the string before the match, will set C<$&> 878 to the part of the string that matched, and will set C<$'> to the part 879 of the string after the match. An example: 880 881 $x = "the cat caught the mouse"; 882 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse' 883 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse' 884 885 In the second match, C<$`> equals C<''> because the regexp matched at the 886 first character position in the string and stopped; it never saw the 887 second 'the'. It is important to note that using C<$`> and C<$'> 888 slows down regexp matching quite a bit, while C<$&> slows it down to a 889 lesser extent, because if they are used in one regexp in a program, 890 they are generated for I<all> regexps in the program. So if raw 891 performance is a goal of your application, they should be avoided. 892 If you need to extract the corresponding substrings, use C<@-> and 893 C<@+> instead: 894 895 $` is the same as substr( $x, 0, $-[0] ) 896 $& is the same as substr( $x, $-[0], $+[0]-$-[0] ) 897 $' is the same as substr( $x, $+[0] ) 898 899 900 =head2 Non-capturing groupings 901 902 A group that is required to bundle a set of alternatives may or may not be 903 useful as a capturing group. If it isn't, it just creates a superfluous 904 addition to the set of available capture buffer values, inside as well as 905 outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>, 906 still allow the regexp to be treated as a single unit, but don't establish 907 a capturing buffer at the same time. Both capturing and non-capturing 908 groupings are allowed to co-exist in the same regexp. Because there is 909 no extraction, non-capturing groupings are faster than capturing 910 groupings. Non-capturing groupings are also handy for choosing exactly 911 which parts of a regexp are to be extracted to matching variables: 912 913 # match a number, $1-$4 are set, but we only want $1 914 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/; 915 916 # match a number faster , only $1 is set 917 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/; 918 919 # match a number, get $1 = whole number, $2 = exponent 920 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/; 921 922 Non-capturing groupings are also useful for removing nuisance 923 elements gathered from a split operation where parentheses are 924 required for some reason: 925 926 $x = '12aba34ba5'; 927 @num = split /(a|b)+/, $x; # @num = ('12','a','34','b','5') 928 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5') 929 930 931 =head2 Matching repetitions 932 933 The examples in the previous section display an annoying weakness. We 934 were only matching 3-letter words, or chunks of words of 4 letters or 935 less. We'd like to be able to match words or, more generally, strings 936 of any length, without writing out tedious alternatives like 937 C<\w\w\w\w|\w\w\w|\w\w|\w>. 938 939 This is exactly the problem the I<quantifier> metacharacters C<?>, 940 C<*>, C<+>, and C<{}> were created for. They allow us to delimit the 941 number of repeats for a portion of a regexp we consider to be a 942 match. Quantifiers are put immediately after the character, character 943 class, or grouping that we want to specify. They have the following 944 meanings: 945 946 =over 4 947 948 =item * 949 950 C<a?> means: match 'a' 1 or 0 times 951 952 =item * 953 954 C<a*> means: match 'a' 0 or more times, i.e., any number of times 955 956 =item * 957 958 C<a+> means: match 'a' 1 or more times, i.e., at least once 959 960 =item * 961 962 C<a{n,m}> means: match at least C<n> times, but not more than C<m> 963 times. 964 965 =item * 966 967 C<a{n,}> means: match at least C<n> or more times 968 969 =item * 970 971 C<a{n}> means: match exactly C<n> times 972 973 =back 974 975 Here are some examples: 976 977 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and 978 # any number of digits 979 /(\w+)\s+\1/; # match doubled words of arbitrary length 980 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes' 981 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more 982 # than 4 digits 983 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates 984 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However, 985 # this produces $1 and the other does not. 986 987 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier? 988 beriberi 989 booboo 990 coco 991 mama 992 murmur 993 papa 994 995 For all of these quantifiers, Perl will try to match as much of the 996 string as possible, while still allowing the regexp to succeed. Thus 997 with C</a?.../>, Perl will first try to match the regexp with the C<a> 998 present; if that fails, Perl will try to match the regexp without the 999 C<a> present. For the quantifier C<*>, we get the following: 1000 1001 $x = "the cat in the hat"; 1002 $x =~ /^(.*)(cat)(.*)$/; # matches, 1003 # $1 = 'the ' 1004 # $2 = 'cat' 1005 # $3 = ' in the hat' 1006 1007 Which is what we might expect, the match finds the only C<cat> in the 1008 string and locks onto it. Consider, however, this regexp: 1009 1010 $x =~ /^(.*)(at)(.*)$/; # matches, 1011 # $1 = 'the cat in the h' 1012 # $2 = 'at' 1013 # $3 = '' (0 characters match) 1014 1015 One might initially guess that Perl would find the C<at> in C<cat> and 1016 stop there, but that wouldn't give the longest possible string to the 1017 first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as 1018 much of the string as possible while still having the regexp match. In 1019 this example, that means having the C<at> sequence with the final C<at> 1020 in the string. The other important principle illustrated here is that 1021 when there are two or more elements in a regexp, the I<leftmost> 1022 quantifier, if there is one, gets to grab as much the string as 1023 possible, leaving the rest of the regexp to fight over scraps. Thus in 1024 our example, the first quantifier C<.*> grabs most of the string, while 1025 the second quantifier C<.*> gets the empty string. Quantifiers that 1026 grab as much of the string as possible are called I<maximal match> or 1027 I<greedy> quantifiers. 1028 1029 When a regexp can match a string in several different ways, we can use 1030 the principles above to predict which way the regexp will match: 1031 1032 =over 4 1033 1034 =item * 1035 1036 Principle 0: Taken as a whole, any regexp will be matched at the 1037 earliest possible position in the string. 1038 1039 =item * 1040 1041 Principle 1: In an alternation C<a|b|c...>, the leftmost alternative 1042 that allows a match for the whole regexp will be the one used. 1043 1044 =item * 1045 1046 Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and 1047 C<{n,m}> will in general match as much of the string as possible while 1048 still allowing the whole regexp to match. 1049 1050 =item * 1051 1052 Principle 3: If there are two or more elements in a regexp, the 1053 leftmost greedy quantifier, if any, will match as much of the string 1054 as possible while still allowing the whole regexp to match. The next 1055 leftmost greedy quantifier, if any, will try to match as much of the 1056 string remaining available to it as possible, while still allowing the 1057 whole regexp to match. And so on, until all the regexp elements are 1058 satisfied. 1059 1060 =back 1061 1062 As we have seen above, Principle 0 overrides the others -- the regexp 1063 will be matched as early as possible, with the other principles 1064 determining how the regexp matches at that earliest character 1065 position. 1066 1067 Here is an example of these principles in action: 1068 1069 $x = "The programming republic of Perl"; 1070 $x =~ /^(.+)(e|r)(.*)$/; # matches, 1071 # $1 = 'The programming republic of Pe' 1072 # $2 = 'r' 1073 # $3 = 'l' 1074 1075 This regexp matches at the earliest string position, C<'T'>. One 1076 might think that C<e>, being leftmost in the alternation, would be 1077 matched, but C<r> produces the longest string in the first quantifier. 1078 1079 $x =~ /(m{1,2})(.*)$/; # matches, 1080 # $1 = 'mm' 1081 # $2 = 'ing republic of Perl' 1082 1083 Here, The earliest possible match is at the first C<'m'> in 1084 C<programming>. C<m{1,2}> is the first quantifier, so it gets to match 1085 a maximal C<mm>. 1086 1087 $x =~ /.*(m{1,2})(.*)$/; # matches, 1088 # $1 = 'm' 1089 # $2 = 'ing republic of Perl' 1090 1091 Here, the regexp matches at the start of the string. The first 1092 quantifier C<.*> grabs as much as possible, leaving just a single 1093 C<'m'> for the second quantifier C<m{1,2}>. 1094 1095 $x =~ /(.?)(m{1,2})(.*)$/; # matches, 1096 # $1 = 'a' 1097 # $2 = 'mm' 1098 # $3 = 'ing republic of Perl' 1099 1100 Here, C<.?> eats its maximal one character at the earliest possible 1101 position in the string, C<'a'> in C<programming>, leaving C<m{1,2}> 1102 the opportunity to match both C<m>'s. Finally, 1103 1104 "aXXXb" =~ /(X*)/; # matches with $1 = '' 1105 1106 because it can match zero copies of C<'X'> at the beginning of the 1107 string. If you definitely want to match at least one C<'X'>, use 1108 C<X+>, not C<X*>. 1109 1110 Sometimes greed is not good. At times, we would like quantifiers to 1111 match a I<minimal> piece of string, rather than a maximal piece. For 1112 this purpose, Larry Wall created the I<minimal match> or 1113 I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are 1114 the usual quantifiers with a C<?> appended to them. They have the 1115 following meanings: 1116 1117 =over 4 1118 1119 =item * 1120 1121 C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1. 1122 1123 =item * 1124 1125 C<a*?> means: match 'a' 0 or more times, i.e., any number of times, 1126 but as few times as possible 1127 1128 =item * 1129 1130 C<a+?> means: match 'a' 1 or more times, i.e., at least once, but 1131 as few times as possible 1132 1133 =item * 1134 1135 C<a{n,m}?> means: match at least C<n> times, not more than C<m> 1136 times, as few times as possible 1137 1138 =item * 1139 1140 C<a{n,}?> means: match at least C<n> times, but as few times as 1141 possible 1142 1143 =item * 1144 1145 C<a{n}?> means: match exactly C<n> times. Because we match exactly 1146 C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for 1147 notational consistency. 1148 1149 =back 1150 1151 Let's look at the example above, but with minimal quantifiers: 1152 1153 $x = "The programming republic of Perl"; 1154 $x =~ /^(.+?)(e|r)(.*)$/; # matches, 1155 # $1 = 'Th' 1156 # $2 = 'e' 1157 # $3 = ' programming republic of Perl' 1158 1159 The minimal string that will allow both the start of the string C<^> 1160 and the alternation to match is C<Th>, with the alternation C<e|r> 1161 matching C<e>. The second quantifier C<.*> is free to gobble up the 1162 rest of the string. 1163 1164 $x =~ /(m{1,2}?)(.*?)$/; # matches, 1165 # $1 = 'm' 1166 # $2 = 'ming republic of Perl' 1167 1168 The first string position that this regexp can match is at the first 1169 C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?> 1170 matches just one C<'m'>. Although the second quantifier C<.*?> would 1171 prefer to match no characters, it is constrained by the end-of-string 1172 anchor C<$> to match the rest of the string. 1173 1174 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches, 1175 # $1 = 'The progra' 1176 # $2 = 'm' 1177 # $3 = 'ming republic of Perl' 1178 1179 In this regexp, you might expect the first minimal quantifier C<.*?> 1180 to match the empty string, because it is not constrained by a C<^> 1181 anchor to match the beginning of the word. Principle 0 applies here, 1182 however. Because it is possible for the whole regexp to match at the 1183 start of the string, it I<will> match at the start of the string. Thus 1184 the first quantifier has to match everything up to the first C<m>. The 1185 second minimal quantifier matches just one C<m> and the third 1186 quantifier matches the rest of the string. 1187 1188 $x =~ /(.??)(m{1,2})(.*)$/; # matches, 1189 # $1 = 'a' 1190 # $2 = 'mm' 1191 # $3 = 'ing republic of Perl' 1192 1193 Just as in the previous regexp, the first quantifier C<.??> can match 1194 earliest at position C<'a'>, so it does. The second quantifier is 1195 greedy, so it matches C<mm>, and the third matches the rest of the 1196 string. 1197 1198 We can modify principle 3 above to take into account non-greedy 1199 quantifiers: 1200 1201 =over 4 1202 1203 =item * 1204 1205 Principle 3: If there are two or more elements in a regexp, the 1206 leftmost greedy (non-greedy) quantifier, if any, will match as much 1207 (little) of the string as possible while still allowing the whole 1208 regexp to match. The next leftmost greedy (non-greedy) quantifier, if 1209 any, will try to match as much (little) of the string remaining 1210 available to it as possible, while still allowing the whole regexp to 1211 match. And so on, until all the regexp elements are satisfied. 1212 1213 =back 1214 1215 Just like alternation, quantifiers are also susceptible to 1216 backtracking. Here is a step-by-step analysis of the example 1217 1218 $x = "the cat in the hat"; 1219 $x =~ /^(.*)(at)(.*)$/; # matches, 1220 # $1 = 'the cat in the h' 1221 # $2 = 'at' 1222 # $3 = '' (0 matches) 1223 1224 =over 4 1225 1226 =item 0 1227 1228 Start with the first letter in the string 't'. 1229 1230 =item 1 1231 1232 The first quantifier '.*' starts out by matching the whole 1233 string 'the cat in the hat'. 1234 1235 =item 2 1236 1237 'a' in the regexp element 'at' doesn't match the end of the 1238 string. Backtrack one character. 1239 1240 =item 3 1241 1242 'a' in the regexp element 'at' still doesn't match the last 1243 letter of the string 't', so backtrack one more character. 1244 1245 =item 4 1246 1247 Now we can match the 'a' and the 't'. 1248 1249 =item 5 1250 1251 Move on to the third element '.*'. Since we are at the end of 1252 the string and '.*' can match 0 times, assign it the empty string. 1253 1254 =item 6 1255 1256 We are done! 1257 1258 =back 1259 1260 Most of the time, all this moving forward and backtracking happens 1261 quickly and searching is fast. There are some pathological regexps, 1262 however, whose execution time exponentially grows with the size of the 1263 string. A typical structure that blows up in your face is of the form 1264 1265 /(a|b+)*/; 1266 1267 The problem is the nested indeterminate quantifiers. There are many 1268 different ways of partitioning a string of length n between the C<+> 1269 and C<*>: one repetition with C<b+> of length n, two repetitions with 1270 the first C<b+> length k and the second with length n-k, m repetitions 1271 whose bits add up to length n, etc. In fact there are an exponential 1272 number of ways to partition a string as a function of its length. A 1273 regexp may get lucky and match early in the process, but if there is 1274 no match, Perl will try I<every> possibility before giving up. So be 1275 careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book 1276 I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful 1277 discussion of this and other efficiency issues. 1278 1279 1280 =head2 Possessive quantifiers 1281 1282 Backtracking during the relentless search for a match may be a waste 1283 of time, particularly when the match is bound to fail. Consider 1284 the simple pattern 1285 1286 /^\w+\s+\w+$/; # a word, spaces, a word 1287 1288 Whenever this is applied to a string which doesn't quite meet the 1289 pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>, 1290 the regex engine will backtrack, approximately once for each character 1291 in the string. But we know that there is no way around taking I<all> 1292 of the initial word characters to match the first repetition, that I<all> 1293 spaces must be eaten by the middle part, and the same goes for the second 1294 word. 1295 1296 With the introduction of the I<possessive quantifiers> in Perl 5.10, we 1297 have a way of instructing the regex engine not to backtrack, with the 1298 usual quantifiers with a C<+> appended to them. This makes them greedy as 1299 well as stingy; once they succeed they won't give anything back to permit 1300 another solution. They have the following meanings: 1301 1302 =over 4 1303 1304 =item * 1305 1306 C<a{n,m}+> means: match at least C<n> times, not more than C<m> times, 1307 as many times as possible, and don't give anything up. C<a?+> is short 1308 for C<a{0,1}+> 1309 1310 =item * 1311 1312 C<a{n,}+> means: match at least C<n> times, but as many times as possible, 1313 and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is 1314 short for C<a{1,}+>. 1315 1316 =item * 1317 1318 C<a{n}+> means: match exactly C<n> times. It is just there for 1319 notational consistency. 1320 1321 =back 1322 1323 These possessive quantifiers represent a special case of a more general 1324 concept, the I<independent subexpression>, see below. 1325 1326 As an example where a possessive quantifier is suitable we consider 1327 matching a quoted string, as it appears in several programming languages. 1328 The backslash is used as an escape character that indicates that the 1329 next character is to be taken literally, as another character for the 1330 string. Therefore, after the opening quote, we expect a (possibly 1331 empty) sequence of alternatives: either some character except an 1332 unescaped quote or backslash or an escaped character. 1333 1334 /"(?:[^"\\]++|\\.)*+"/; 1335 1336 1337 =head2 Building a regexp 1338 1339 At this point, we have all the basic regexp concepts covered, so let's 1340 give a more involved example of a regular expression. We will build a 1341 regexp that matches numbers. 1342 1343 The first task in building a regexp is to decide what we want to match 1344 and what we want to exclude. In our case, we want to match both 1345 integers and floating point numbers and we want to reject any string 1346 that isn't a number. 1347 1348 The next task is to break the problem down into smaller problems that 1349 are easily converted into a regexp. 1350 1351 The simplest case is integers. These consist of a sequence of digits, 1352 with an optional sign in front. The digits we can represent with 1353 C<\d+> and the sign can be matched with C<[+-]>. Thus the integer 1354 regexp is 1355 1356 /[+-]?\d+/; # matches integers 1357 1358 A floating point number potentially has a sign, an integral part, a 1359 decimal point, a fractional part, and an exponent. One or more of these 1360 parts is optional, so we need to check out the different 1361 possibilities. Floating point numbers which are in proper form include 1362 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out 1363 front is completely optional and can be matched by C<[+-]?>. We can 1364 see that if there is no exponent, floating point numbers must have a 1365 decimal point, otherwise they are integers. We might be tempted to 1366 model these with C<\d*\.\d*>, but this would also match just a single 1367 decimal point, which is not a number. So the three cases of floating 1368 point number without exponent are 1369 1370 /[+-]?\d+\./; # 1., 321., etc. 1371 /[+-]?\.\d+/; # .1, .234, etc. 1372 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc. 1373 1374 These can be combined into a single regexp with a three-way alternation: 1375 1376 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent 1377 1378 In this alternation, it is important to put C<'\d+\.\d+'> before 1379 C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that 1380 and ignore the fractional part of the number. 1381 1382 Now consider floating point numbers with exponents. The key 1383 observation here is that I<both> integers and numbers with decimal 1384 points are allowed in front of an exponent. Then exponents, like the 1385 overall sign, are independent of whether we are matching numbers with 1386 or without decimal points, and can be 'decoupled' from the 1387 mantissa. The overall form of the regexp now becomes clear: 1388 1389 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/; 1390 1391 The exponent is an C<e> or C<E>, followed by an integer. So the 1392 exponent regexp is 1393 1394 /[eE][+-]?\d+/; # exponent 1395 1396 Putting all the parts together, we get a regexp that matches numbers: 1397 1398 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da! 1399 1400 Long regexps like this may impress your friends, but can be hard to 1401 decipher. In complex situations like this, the C<//x> modifier for a 1402 match is invaluable. It allows one to put nearly arbitrary whitespace 1403 and comments into a regexp without affecting their meaning. Using it, 1404 we can rewrite our 'extended' regexp in the more pleasing form 1405 1406 /^ 1407 [+-]? # first, match an optional sign 1408 ( # then match integers or f.p. mantissas: 1409 \d+\.\d+ # mantissa of the form a.b 1410 |\d+\. # mantissa of the form a. 1411 |\.\d+ # mantissa of the form .b 1412 |\d+ # integer of the form a 1413 ) 1414 ([eE][+-]?\d+)? # finally, optionally match an exponent 1415 $/x; 1416 1417 If whitespace is mostly irrelevant, how does one include space 1418 characters in an extended regexp? The answer is to backslash it 1419 S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing 1420 goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows 1421 a space between the sign and the mantissa or integer, and we could add 1422 this to our regexp as follows: 1423 1424 /^ 1425 [+-]?\ * # first, match an optional sign *and space* 1426 ( # then match integers or f.p. mantissas: 1427 \d+\.\d+ # mantissa of the form a.b 1428 |\d+\. # mantissa of the form a. 1429 |\.\d+ # mantissa of the form .b 1430 |\d+ # integer of the form a 1431 ) 1432 ([eE][+-]?\d+)? # finally, optionally match an exponent 1433 $/x; 1434 1435 In this form, it is easier to see a way to simplify the 1436 alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it 1437 could be factored out: 1438 1439 /^ 1440 [+-]?\ * # first, match an optional sign 1441 ( # then match integers or f.p. mantissas: 1442 \d+ # start out with a ... 1443 ( 1444 \.\d* # mantissa of the form a.b or a. 1445 )? # ? takes care of integers of the form a 1446 |\.\d+ # mantissa of the form .b 1447 ) 1448 ([eE][+-]?\d+)? # finally, optionally match an exponent 1449 $/x; 1450 1451 or written in the compact form, 1452 1453 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/; 1454 1455 This is our final regexp. To recap, we built a regexp by 1456 1457 =over 4 1458 1459 =item * 1460 1461 specifying the task in detail, 1462 1463 =item * 1464 1465 breaking down the problem into smaller parts, 1466 1467 =item * 1468 1469 translating the small parts into regexps, 1470 1471 =item * 1472 1473 combining the regexps, 1474 1475 =item * 1476 1477 and optimizing the final combined regexp. 1478 1479 =back 1480 1481 These are also the typical steps involved in writing a computer 1482 program. This makes perfect sense, because regular expressions are 1483 essentially programs written in a little computer language that specifies 1484 patterns. 1485 1486 =head2 Using regular expressions in Perl 1487 1488 The last topic of Part 1 briefly covers how regexps are used in Perl 1489 programs. Where do they fit into Perl syntax? 1490 1491 We have already introduced the matching operator in its default 1492 C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used 1493 the binding operator C<=~> and its negation C<!~> to test for string 1494 matches. Associated with the matching operator, we have discussed the 1495 single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and 1496 extended C<//x> modifiers. There are a few more things you might 1497 want to know about matching operators. 1498 1499 =head3 Optimizing pattern evaluation 1500 1501 We pointed out earlier that variables in regexps are substituted 1502 before the regexp is evaluated: 1503 1504 $pattern = 'Seuss'; 1505 while (<>) { 1506 print if /$pattern/; 1507 } 1508 1509 This will print any lines containing the word C<Seuss>. It is not as 1510 efficient as it could be, however, because Perl has to re-evaluate 1511 (or compile) C<$pattern> each time through the loop. If C<$pattern> won't be 1512 changing over the lifetime of the script, we can add the C<//o> 1513 modifier, which directs Perl to only perform variable substitutions 1514 once: 1515 1516 #!/usr/bin/perl 1517 # Improved simple_grep 1518 $regexp = shift; 1519 while (<>) { 1520 print if /$regexp/o; # a good deal faster 1521 } 1522 1523 1524 =head3 Prohibiting substitution 1525 1526 If you change C<$pattern> after the first substitution happens, Perl 1527 will ignore it. If you don't want any substitutions at all, use the 1528 special delimiter C<m''>: 1529 1530 @pattern = ('Seuss'); 1531 while (<>) { 1532 print if m'@pattern'; # matches literal '@pattern', not 'Seuss' 1533 } 1534 1535 Similar to strings, C<m''> acts like apostrophes on a regexp; all other 1536 C<m> delimiters act like quotes. If the regexp evaluates to the empty string, 1537 the regexp in the I<last successful match> is used instead. So we have 1538 1539 "dog" =~ /d/; # 'd' matches 1540 "dogbert =~ //; # this matches the 'd' regexp used before 1541 1542 1543 =head3 Global matching 1544 1545 The final two modifiers C<//g> and C<//c> concern multiple matches. 1546 The modifier C<//g> stands for global matching and allows the 1547 matching operator to match within a string as many times as possible. 1548 In scalar context, successive invocations against a string will have 1549 `C<//g> jump from match to match, keeping track of position in the 1550 string as it goes along. You can get or set the position with the 1551 C<pos()> function. 1552 1553 The use of C<//g> is shown in the following example. Suppose we have 1554 a string that consists of words separated by spaces. If we know how 1555 many words there are in advance, we could extract the words using 1556 groupings: 1557 1558 $x = "cat dog house"; # 3 words 1559 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches, 1560 # $1 = 'cat' 1561 # $2 = 'dog' 1562 # $3 = 'house' 1563 1564 But what if we had an indeterminate number of words? This is the sort 1565 of task C<//g> was made for. To extract all words, form the simple 1566 regexp C<(\w+)> and loop over all matches with C</(\w+)/g>: 1567 1568 while ($x =~ /(\w+)/g) { 1569 print "Word is $1, ends at position ", pos $x, "\n"; 1570 } 1571 1572 prints 1573 1574 Word is cat, ends at position 3 1575 Word is dog, ends at position 7 1576 Word is house, ends at position 13 1577 1578 A failed match or changing the target string resets the position. If 1579 you don't want the position reset after failure to match, add the 1580 C<//c>, as in C</regexp/gc>. The current position in the string is 1581 associated with the string, not the regexp. This means that different 1582 strings have different positions and their respective positions can be 1583 set or read independently. 1584 1585 In list context, C<//g> returns a list of matched groupings, or if 1586 there are no groupings, a list of matches to the whole regexp. So if 1587 we wanted just the words, we could use 1588 1589 @words = ($x =~ /(\w+)/g); # matches, 1590 # $word[0] = 'cat' 1591 # $word[1] = 'dog' 1592 # $word[2] = 'house' 1593 1594 Closely associated with the C<//g> modifier is the C<\G> anchor. The 1595 C<\G> anchor matches at the point where the previous C<//g> match left 1596 off. C<\G> allows us to easily do context-sensitive matching: 1597 1598 $metric = 1; # use metric units 1599 ... 1600 $x = <FILE>; # read in measurement 1601 $x =~ /^([+-]?\d+)\s*/g; # get magnitude 1602 $weight = $1; 1603 if ($metric) { # error checking 1604 print "Units error!" unless $x =~ /\Gkg\./g; 1605 } 1606 else { 1607 print "Units error!" unless $x =~ /\Glbs\./g; 1608 } 1609 $x =~ /\G\s+(widget|sprocket)/g; # continue processing 1610 1611 The combination of C<//g> and C<\G> allows us to process the string a 1612 bit at a time and use arbitrary Perl logic to decide what to do next. 1613 Currently, the C<\G> anchor is only fully supported when used to anchor 1614 to the start of the pattern. 1615 1616 C<\G> is also invaluable in processing fixed length records with 1617 regexps. Suppose we have a snippet of coding region DNA, encoded as 1618 base pair letters C<ATCGTTGAAT...> and we want to find all the stop 1619 codons C<TGA>. In a coding region, codons are 3-letter sequences, so 1620 we can think of the DNA snippet as a sequence of 3-letter records. The 1621 naive regexp 1622 1623 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC" 1624 $dna = "ATCGTTGAATGCAAATGACATGAC"; 1625 $dna =~ /TGA/; 1626 1627 doesn't work; it may match a C<TGA>, but there is no guarantee that 1628 the match is aligned with codon boundaries, e.g., the substring 1629 S<C<GTT GAA>> gives a match. A better solution is 1630 1631 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *? 1632 print "Got a TGA stop codon at position ", pos $dna, "\n"; 1633 } 1634 1635 which prints 1636 1637 Got a TGA stop codon at position 18 1638 Got a TGA stop codon at position 23 1639 1640 Position 18 is good, but position 23 is bogus. What happened? 1641 1642 The answer is that our regexp works well until we get past the last 1643 real match. Then the regexp will fail to match a synchronized C<TGA> 1644 and start stepping ahead one character position at a time, not what we 1645 want. The solution is to use C<\G> to anchor the match to the codon 1646 alignment: 1647 1648 while ($dna =~ /\G(\w\w\w)*?TGA/g) { 1649 print "Got a TGA stop codon at position ", pos $dna, "\n"; 1650 } 1651 1652 This prints 1653 1654 Got a TGA stop codon at position 18 1655 1656 which is the correct answer. This example illustrates that it is 1657 important not only to match what is desired, but to reject what is not 1658 desired. 1659 1660 =head3 Search and replace 1661 1662 Regular expressions also play a big role in I<search and replace> 1663 operations in Perl. Search and replace is accomplished with the 1664 C<s///> operator. The general form is 1665 C<s/regexp/replacement/modifiers>, with everything we know about 1666 regexps and modifiers applying in this case as well. The 1667 C<replacement> is a Perl double quoted string that replaces in the 1668 string whatever is matched with the C<regexp>. The operator C<=~> is 1669 also used here to associate a string with C<s///>. If matching 1670 against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match, 1671 C<s///> returns the number of substitutions made, otherwise it returns 1672 false. Here are a few examples: 1673 1674 $x = "Time to feed the cat!"; 1675 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!" 1676 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) { 1677 $more_insistent = 1; 1678 } 1679 $y = "'quoted words'"; 1680 $y =~ s/^'(.*)'$/$1/; # strip single quotes, 1681 # $y contains "quoted words" 1682 1683 In the last example, the whole string was matched, but only the part 1684 inside the single quotes was grouped. With the C<s///> operator, the 1685 matched variables C<$1>, C<$2>, etc. are immediately available for use 1686 in the replacement expression, so we use C<$1> to replace the quoted 1687 string with just what was quoted. With the global modifier, C<s///g> 1688 will search and replace all occurrences of the regexp in the string: 1689 1690 $x = "I batted 4 for 4"; 1691 $x =~ s/4/four/; # doesn't do it all: 1692 # $x contains "I batted four for 4" 1693 $x = "I batted 4 for 4"; 1694 $x =~ s/4/four/g; # does it all: 1695 # $x contains "I batted four for four" 1696 1697 If you prefer 'regex' over 'regexp' in this tutorial, you could use 1698 the following program to replace it: 1699 1700 % cat > simple_replace 1701 #!/usr/bin/perl 1702 $regexp = shift; 1703 $replacement = shift; 1704 while (<>) { 1705 s/$regexp/$replacement/go; 1706 print; 1707 } 1708 ^D 1709 1710 % simple_replace regexp regex perlretut.pod 1711 1712 In C<simple_replace> we used the C<s///g> modifier to replace all 1713 occurrences of the regexp on each line and the C<s///o> modifier to 1714 compile the regexp only once. As with C<simple_grep>, both the 1715 C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly. 1716 1717 A modifier available specifically to search and replace is the 1718 C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around 1719 the replacement string and the evaluated result is substituted for the 1720 matched substring. C<s///e> is useful if you need to do a bit of 1721 computation in the process of replacing text. This example counts 1722 character frequencies in a line: 1723 1724 $x = "Bill the cat"; 1725 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself 1726 print "frequency of '$_' is $chars{$_}\n" 1727 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars); 1728 1729 This prints 1730 1731 frequency of ' ' is 2 1732 frequency of 't' is 2 1733 frequency of 'l' is 2 1734 frequency of 'B' is 1 1735 frequency of 'c' is 1 1736 frequency of 'e' is 1 1737 frequency of 'h' is 1 1738 frequency of 'i' is 1 1739 frequency of 'a' is 1 1740 1741 As with the match C<m//> operator, C<s///> can use other delimiters, 1742 such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are 1743 used C<s'''>, then the regexp and replacement are treated as single 1744 quoted strings and there are no substitutions. C<s///> in list context 1745 returns the same thing as in scalar context, i.e., the number of 1746 matches. 1747 1748 =head3 The split function 1749 1750 The C<split()> function is another place where a regexp is used. 1751 C<split /regexp/, string, limit> separates the C<string> operand into 1752 a list of substrings and returns that list. The regexp must be designed 1753 to match whatever constitutes the separators for the desired substrings. 1754 The C<limit>, if present, constrains splitting into no more than C<limit> 1755 number of strings. For example, to split a string into words, use 1756 1757 $x = "Calvin and Hobbes"; 1758 @words = split /\s+/, $x; # $word[0] = 'Calvin' 1759 # $word[1] = 'and' 1760 # $word[2] = 'Hobbes' 1761 1762 If the empty regexp C<//> is used, the regexp always matches and 1763 the string is split into individual characters. If the regexp has 1764 groupings, then the resulting list contains the matched substrings from the 1765 groupings as well. For instance, 1766 1767 $x = "/usr/bin/perl"; 1768 @dirs = split m!/!, $x; # $dirs[0] = '' 1769 # $dirs[1] = 'usr' 1770 # $dirs[2] = 'bin' 1771 # $dirs[3] = 'perl' 1772 @parts = split m!(/)!, $x; # $parts[0] = '' 1773 # $parts[1] = '/' 1774 # $parts[2] = 'usr' 1775 # $parts[3] = '/' 1776 # $parts[4] = 'bin' 1777 # $parts[5] = '/' 1778 # $parts[6] = 'perl' 1779 1780 Since the first character of $x matched the regexp, C<split> prepended 1781 an empty initial element to the list. 1782 1783 If you have read this far, congratulations! You now have all the basic 1784 tools needed to use regular expressions to solve a wide range of text 1785 processing problems. If this is your first time through the tutorial, 1786 why not stop here and play around with regexps a while... S<Part 2> 1787 concerns the more esoteric aspects of regular expressions and those 1788 concepts certainly aren't needed right at the start. 1789 1790 =head1 Part 2: Power tools 1791 1792 OK, you know the basics of regexps and you want to know more. If 1793 matching regular expressions is analogous to a walk in the woods, then 1794 the tools discussed in Part 1 are analogous to topo maps and a 1795 compass, basic tools we use all the time. Most of the tools in part 2 1796 are analogous to flare guns and satellite phones. They aren't used 1797 too often on a hike, but when we are stuck, they can be invaluable. 1798 1799 What follows are the more advanced, less used, or sometimes esoteric 1800 capabilities of Perl regexps. In Part 2, we will assume you are 1801 comfortable with the basics and concentrate on the new features. 1802 1803 =head2 More on characters, strings, and character classes 1804 1805 There are a number of escape sequences and character classes that we 1806 haven't covered yet. 1807 1808 There are several escape sequences that convert characters or strings 1809 between upper and lower case, and they are also available within 1810 patterns. C<\l> and C<\u> convert the next character to lower or 1811 upper case, respectively: 1812 1813 $x = "perl"; 1814 $string =~ /\u$x/; # matches 'Perl' in $string 1815 $x = "M(rs?|s)\\."; # note the double backslash 1816 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.', 1817 1818 A C<\L> or C<\U> indicates a lasting conversion of case, until 1819 terminated by C<\E> or thrown over by another C<\U> or C<\L>: 1820 1821 $x = "This word is in lower case:\L SHOUT\E"; 1822 $x =~ /shout/; # matches 1823 $x = "I STILL KEYPUNCH CARDS FOR MY 360" 1824 $x =~ /\Ukeypunch/; # matches punch card string 1825 1826 If there is no C<\E>, case is converted until the end of the 1827 string. The regexps C<\L\u$word> or C<\u\L$word> convert the first 1828 character of C<$word> to uppercase and the rest of the characters to 1829 lowercase. 1830 1831 Control characters can be escaped with C<\c>, so that a control-Z 1832 character would be matched with C<\cZ>. The escape sequence 1833 C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For 1834 instance, 1835 1836 $x = "\QThat !^*&%~& cat!"; 1837 $x =~ /\Q!^*&%~&\E/; # check for rough language 1838 1839 It does not protect C<$> or C<@>, so that variables can still be 1840 substituted. 1841 1842 With the advent of 5.6.0, Perl regexps can handle more than just the 1843 standard ASCII character set. Perl now supports I<Unicode>, a standard 1844 for representing the alphabets from virtually all of the world's written 1845 languages, and a host of symbols. Perl's text strings are Unicode strings, so 1846 they can contain characters with a value (codepoint or character number) higher 1847 than 255 1848 1849 What does this mean for regexps? Well, regexp users don't need to know 1850 much about Perl's internal representation of strings. But they do need 1851 to know 1) how to represent Unicode characters in a regexp and 2) that 1852 a matching operation will treat the string to be searched as a sequence 1853 of characters, not bytes. The answer to 1) is that Unicode characters 1854 greater than C<chr(255)> are represented using the C<\x{hex}> notation, 1855 because the \0 octal and \x hex (without curly braces) don't go further 1856 than 255. 1857 1858 /\x{263a}/; # match a Unicode smiley face :) 1859 1860 B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use 1861 utf8> to use any Unicode features. This is no more the case: for 1862 almost all Unicode processing, the explicit C<utf8> pragma is not 1863 needed. (The only case where it matters is if your Perl script is in 1864 Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.) 1865 1866 Figuring out the hexadecimal sequence of a Unicode character you want 1867 or deciphering someone else's hexadecimal Unicode regexp is about as 1868 much fun as programming in machine code. So another way to specify 1869 Unicode characters is to use the I<named character>> escape 1870 sequence C<\N{name}>. C<name> is a name for the Unicode character, as 1871 specified in the Unicode standard. For instance, if we wanted to 1872 represent or match the astrological sign for the planet Mercury, we 1873 could use 1874 1875 use charnames ":full"; # use named chars with Unicode full names 1876 $x = "abc\N{MERCURY}def"; 1877 $x =~ /\N{MERCURY}/; # matches 1878 1879 One can also use short names or restrict names to a certain alphabet: 1880 1881 use charnames ':full'; 1882 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n"; 1883 1884 use charnames ":short"; 1885 print "\N{greek:Sigma} is an upper-case sigma.\n"; 1886 1887 use charnames qw(greek); 1888 print "\N{sigma} is Greek sigma\n"; 1889 1890 A list of full names is found in the file NamesList.txt in the 1891 lib/perl5/X.X.X/unicore directory (where X.X.X is the perl 1892 version number as it is installed on your system). 1893 1894 The answer to requirement 2), as of 5.6.0, is that a regexp uses Unicode 1895 characters. Internally, this is encoded to bytes using either UTF-8 or a 1896 native 8 bit encoding, depending on the history of the string, but 1897 conceptually it is a sequence of characters, not bytes. See 1898 L<perlunitut> for a tutorial about that. 1899 1900 Let us now discuss Unicode character classes. Just as with Unicode 1901 characters, there are named Unicode character classes represented by the 1902 C<\p{name}> escape sequence. Closely associated is the C<\P{name}> 1903 character class, which is the negation of the C<\p{name}> class. For 1904 example, to match lower and uppercase characters, 1905 1906 use charnames ":full"; # use named chars with Unicode full names 1907 $x = "BOB"; 1908 $x =~ /^\p{IsUpper}/; # matches, uppercase char class 1909 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase 1910 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class 1911 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase 1912 1913 Here is the association between some Perl named classes and the 1914 traditional Unicode classes: 1915 1916 Perl class name Unicode class name or regular expression 1917 1918 IsAlpha /^[LM]/ 1919 IsAlnum /^[LMN]/ 1920 IsASCII $code <= 127 1921 IsCntrl /^C/ 1922 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/ 1923 IsDigit Nd 1924 IsGraph /^([LMNPS]|Co)/ 1925 IsLower Ll 1926 IsPrint /^([LMNPS]|Co|Zs)/ 1927 IsPunct /^P/ 1928 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/ 1929 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/ 1930 IsUpper /^L[ut]/ 1931 IsWord /^[LMN]/ || $code eq "005F" 1932 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/ 1933 1934 You can also use the official Unicode class names with the C<\p> and 1935 C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase 1936 letters, or C<\P{Nd}> for non-digits. If a C<name> is just one 1937 letter, the braces can be dropped. For instance, C<\pM> is the 1938 character class of Unicode 'marks', for example accent marks. 1939 For the full list see L<perlunicode>. 1940 1941 The Unicode has also been separated into various sets of characters 1942 which you can test with C<\p{...}> (in) and C<\P{...}> (not in). 1943 To test whether a character is (or is not) an element of a script 1944 you would use the script name, for example C<\p{Latin}>, C<\p{Greek}>, 1945 or C<\P{Katakana}>. Other sets are the Unicode blocks, the names 1946 of which begin with "In". One such block is dedicated to mathematical 1947 operators, and its pattern formula is <C\p{InMathematicalOperators>}>. 1948 For the full list see L<perlunicode>. 1949 1950 C<\X> is an abbreviation for a character class that comprises 1951 the Unicode I<combining character sequences>. A combining character 1952 sequence is a base character followed by any number of diacritics, i.e., 1953 signs like accents used to indicate different sounds of a letter. Using 1954 the Unicode full names, e.g., S<C<A + COMBINING RING>> is a combining 1955 character sequence with base character C<A> and combining character 1956 S<C<COMBINING RING>>, which translates in Danish to A with the circle 1957 atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>, 1958 i.e., a non-mark followed by one or more marks. 1959 1960 For the full and latest information about Unicode see the latest 1961 Unicode standard, or the Unicode Consortium's website http://www.unicode.org/ 1962 1963 As if all those classes weren't enough, Perl also defines POSIX style 1964 character classes. These have the form C<[:name:]>, with C<name> the 1965 name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>, 1966 C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>, 1967 C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl 1968 extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8> 1969 is being used, then these classes are defined the same as their 1970 corresponding Perl Unicode classes: C<[:upper:]> is the same as 1971 C<\p{IsUpper}>, etc. The POSIX character classes, however, don't 1972 require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and 1973 C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s> 1974 character classes. To negate a POSIX class, put a C<^> in front of 1975 the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under 1976 C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can 1977 be used just like C<\d>, with the exception that POSIX character 1978 classes can only be used inside of a character class: 1979 1980 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit 1981 /^=item\s[[:digit:]]/; # match '=item', 1982 # followed by a space and a digit 1983 use charnames ":full"; 1984 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit 1985 /^=item\s\p{IsDigit}/; # match '=item', 1986 # followed by a space and a digit 1987 1988 Whew! That is all the rest of the characters and character classes. 1989 1990 =head2 Compiling and saving regular expressions 1991 1992 In Part 1 we discussed the C<//o> modifier, which compiles a regexp 1993 just once. This suggests that a compiled regexp is some data structure 1994 that can be stored once and used again and again. The regexp quote 1995 C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a 1996 regexp and transforms the result into a form that can be assigned to a 1997 variable: 1998 1999 $reg = qr/foo+bar?/; # reg contains a compiled regexp 2000 2001 Then C<$reg> can be used as a regexp: 2002 2003 $x = "fooooba"; 2004 $x =~ $reg; # matches, just like /foo+bar?/ 2005 $x =~ /$reg/; # same thing, alternate form 2006 2007 C<$reg> can also be interpolated into a larger regexp: 2008 2009 $x =~ /(abc)?$reg/; # still matches 2010 2011 As with the matching operator, the regexp quote can use different 2012 delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes 2013 as delimiters (C<qr''>) inhibit any interpolation. 2014 2015 Pre-compiled regexps are useful for creating dynamic matches that 2016 don't need to be recompiled each time they are encountered. Using 2017 pre-compiled regexps, we write a C<grep_step> program which greps 2018 for a sequence of patterns, advancing to the next pattern as soon 2019 as one has been satisfied. 2020 2021 % cat > grep_step 2022 #!/usr/bin/perl 2023 # grep_step - match <number> regexps, one after the other 2024 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ... 2025 2026 $number = shift; 2027 $regexp[$_] = shift foreach (0..$number-1); 2028 @compiled = map qr/$_/, @regexp; 2029 while ($line = <>) { 2030 if ($line =~ /$compiled[0]/) { 2031 print $line; 2032 shift @compiled; 2033 last unless @compiled; 2034 } 2035 } 2036 ^D 2037 2038 % grep_step 3 shift print last grep_step 2039 $number = shift; 2040 print $line; 2041 last unless @compiled; 2042 2043 Storing pre-compiled regexps in an array C<@compiled> allows us to 2044 simply loop through the regexps without any recompilation, thus gaining 2045 flexibility without sacrificing speed. 2046 2047 2048 =head2 Composing regular expressions at runtime 2049 2050 Backtracking is more efficient than repeated tries with different regular 2051 expressions. If there are several regular expressions and a match with 2052 any of them is acceptable, then it is possible to combine them into a set 2053 of alternatives. If the individual expressions are input data, this 2054 can be done by programming a join operation. We'll exploit this idea in 2055 an improved version of the C<simple_grep> program: a program that matches 2056 multiple patterns: 2057 2058 % cat > multi_grep 2059 #!/usr/bin/perl 2060 # multi_grep - match any of <number> regexps 2061 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ... 2062 2063 $number = shift; 2064 $regexp[$_] = shift foreach (0..$number-1); 2065 $pattern = join '|', @regexp; 2066 2067 while ($line = <>) { 2068 print $line if $line =~ /$pattern/o; 2069 } 2070 ^D 2071 2072 % multi_grep 2 shift for multi_grep 2073 $number = shift; 2074 $regexp[$_] = shift foreach (0..$number-1); 2075 2076 Sometimes it is advantageous to construct a pattern from the I<input> 2077 that is to be analyzed and use the permissible values on the left 2078 hand side of the matching operations. As an example for this somewhat 2079 paradoxical situation, let's assume that our input contains a command 2080 verb which should match one out of a set of available command verbs, 2081 with the additional twist that commands may be abbreviated as long as 2082 the given string is unique. The program below demonstrates the basic 2083 algorithm. 2084 2085 % cat > keymatch 2086 #!/usr/bin/perl 2087 $kwds = 'copy compare list print'; 2088 while( $command = <> ){ 2089 $command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces 2090 if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){ 2091 print "command: '$matches'\n"; 2092 } elsif( @matches == 0 ){ 2093 print "no such command: '$command'\n"; 2094 } else { 2095 print "not unique: '$command' (could be one of: @matches)\n"; 2096 } 2097 } 2098 ^D 2099 2100 % keymatch 2101 li 2102 command: 'list' 2103 co 2104 not unique: 'co' (could be one of: copy compare) 2105 printer 2106 no such command: 'printer' 2107 2108 Rather than trying to match the input against the keywords, we match the 2109 combined set of keywords against the input. The pattern matching 2110 operation S<C<$kwds =~ /\b($command\w*)/g>> does several things at the 2111 same time. It makes sure that the given command begins where a keyword 2112 begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It 2113 tells us the number of matches (C<scalar @matches>) and all the keywords 2114 that were actually matched. You could hardly ask for more. 2115 2116 =head2 Embedding comments and modifiers in a regular expression 2117 2118 Starting with this section, we will be discussing Perl's set of 2119 I<extended patterns>. These are extensions to the traditional regular 2120 expression syntax that provide powerful new tools for pattern 2121 matching. We have already seen extensions in the form of the minimal 2122 matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The 2123 rest of the extensions below have the form C<(?char...)>, where the 2124 C<char> is a character that determines the type of extension. 2125 2126 The first extension is an embedded comment C<(?#text)>. This embeds a 2127 comment into the regular expression without affecting its meaning. The 2128 comment should not have any closing parentheses in the text. An 2129 example is 2130 2131 /(?# Match an integer:)[+-]?\d+/; 2132 2133 This style of commenting has been largely superseded by the raw, 2134 freeform commenting that is allowed with the C<//x> modifier. 2135 2136 The modifiers C<//i>, C<//m>, C<//s>, C<//x> and C<//k> (or any 2137 combination thereof) can also embedded in 2138 a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance, 2139 2140 /(?i)yes/; # match 'yes' case insensitively 2141 /yes/i; # same thing 2142 /(?x)( # freeform version of an integer regexp 2143 [+-]? # match an optional sign 2144 \d+ # match a sequence of digits 2145 ) 2146 /x; 2147 2148 Embedded modifiers can have two important advantages over the usual 2149 modifiers. Embedded modifiers allow a custom set of modifiers to 2150 I<each> regexp pattern. This is great for matching an array of regexps 2151 that must have different modifiers: 2152 2153 $pattern[0] = '(?i)doctor'; 2154 $pattern[1] = 'Johnson'; 2155 ... 2156 while (<>) { 2157 foreach $patt (@pattern) { 2158 print if /$patt/; 2159 } 2160 } 2161 2162 The second advantage is that embedded modifiers (except C<//k>, which 2163 modifies the entire regexp) only affect the regexp 2164 inside the group the embedded modifier is contained in. So grouping 2165 can be used to localize the modifier's effects: 2166 2167 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc. 2168 2169 Embedded modifiers can also turn off any modifiers already present 2170 by using, e.g., C<(?-i)>. Modifiers can also be combined into 2171 a single expression, e.g., C<(?s-i)> turns on single line mode and 2172 turns off case insensitivity. 2173 2174 Embedded modifiers may also be added to a non-capturing grouping. 2175 C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp> 2176 case insensitively and turns off multi-line mode. 2177 2178 2179 =head2 Looking ahead and looking behind 2180 2181 This section concerns the lookahead and lookbehind assertions. First, 2182 a little background. 2183 2184 In Perl regular expressions, most regexp elements 'eat up' a certain 2185 amount of string when they match. For instance, the regexp element 2186 C<[abc}]> eats up one character of the string when it matches, in the 2187 sense that Perl moves to the next character position in the string 2188 after the match. There are some elements, however, that don't eat up 2189 characters (advance the character position) if they match. The examples 2190 we have seen so far are the anchors. The anchor C<^> matches the 2191 beginning of the line, but doesn't eat any characters. Similarly, the 2192 word boundary anchor C<\b> matches wherever a character matching C<\w> 2193 is next to a character that doesn't, but it doesn't eat up any 2194 characters itself. Anchors are examples of I<zero-width assertions>. 2195 Zero-width, because they consume 2196 no characters, and assertions, because they test some property of the 2197 string. In the context of our walk in the woods analogy to regexp 2198 matching, most regexp elements move us along a trail, but anchors have 2199 us stop a moment and check our surroundings. If the local environment 2200 checks out, we can proceed forward. But if the local environment 2201 doesn't satisfy us, we must backtrack. 2202 2203 Checking the environment entails either looking ahead on the trail, 2204 looking behind, or both. C<^> looks behind, to see that there are no 2205 characters before. C<$> looks ahead, to see that there are no 2206 characters after. C<\b> looks both ahead and behind, to see if the 2207 characters on either side differ in their "word-ness". 2208 2209 The lookahead and lookbehind assertions are generalizations of the 2210 anchor concept. Lookahead and lookbehind are zero-width assertions 2211 that let us specify which characters we want to test for. The 2212 lookahead assertion is denoted by C<(?=regexp)> and the lookbehind 2213 assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are 2214 2215 $x = "I catch the housecat 'Tom-cat' with catnip"; 2216 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat' 2217 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches, 2218 # $catwords[0] = 'catch' 2219 # $catwords[1] = 'catnip' 2220 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat' 2221 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in 2222 # middle of $x 2223 2224 Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are 2225 non-capturing, since these are zero-width assertions. Thus in the 2226 second regexp, the substrings captured are those of the whole regexp 2227 itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but 2228 lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed 2229 width, i.e., a fixed number of characters long. Thus 2230 C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The 2231 negated versions of the lookahead and lookbehind assertions are 2232 denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively. 2233 They evaluate true if the regexps do I<not> match: 2234 2235 $x = "foobar"; 2236 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo' 2237 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo' 2238 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo' 2239 2240 The C<\C> is unsupported in lookbehind, because the already 2241 treacherous definition of C<\C> would become even more so 2242 when going backwards. 2243 2244 Here is an example where a string containing blank-separated words, 2245 numbers and single dashes is to be split into its components. 2246 Using C</\s+/> alone won't work, because spaces are not required between 2247 dashes, or a word or a dash. Additional places for a split are established 2248 by looking ahead and behind: 2249 2250 $str = "one two - --6-8"; 2251 @toks = split / \s+ # a run of spaces 2252 | (?<=\S) (?=-) # any non-space followed by '-' 2253 | (?<=-) (?=\S) # a '-' followed by any non-space 2254 /x, $str; # @toks = qw(one two - - - 6 - 8) 2255 2256 2257 =head2 Using independent subexpressions to prevent backtracking 2258 2259 I<Independent subexpressions> are regular expressions, in the 2260 context of a larger regular expression, that function independently of 2261 the larger regular expression. That is, they consume as much or as 2262 little of the string as they wish without regard for the ability of 2263 the larger regexp to match. Independent subexpressions are represented 2264 by C<< (?>regexp) >>. We can illustrate their behavior by first 2265 considering an ordinary regexp: 2266 2267 $x = "ab"; 2268 $x =~ /a*ab/; # matches 2269 2270 This obviously matches, but in the process of matching, the 2271 subexpression C<a*> first grabbed the C<a>. Doing so, however, 2272 wouldn't allow the whole regexp to match, so after backtracking, C<a*> 2273 eventually gave back the C<a> and matched the empty string. Here, what 2274 C<a*> matched was I<dependent> on what the rest of the regexp matched. 2275 2276 Contrast that with an independent subexpression: 2277 2278 $x =~ /(?>a*)ab/; # doesn't match! 2279 2280 The independent subexpression C<< (?>a*) >> doesn't care about the rest 2281 of the regexp, so it sees an C<a> and grabs it. Then the rest of the 2282 regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there 2283 is no backtracking and the independent subexpression does not give 2284 up its C<a>. Thus the match of the regexp as a whole fails. A similar 2285 behavior occurs with completely independent regexps: 2286 2287 $x = "ab"; 2288 $x =~ /a*/g; # matches, eats an 'a' 2289 $x =~ /\Gab/g; # doesn't match, no 'a' available 2290 2291 Here C<//g> and C<\G> create a 'tag team' handoff of the string from 2292 one regexp to the other. Regexps with an independent subexpression are 2293 much like this, with a handoff of the string to the independent 2294 subexpression, and a handoff of the string back to the enclosing 2295 regexp. 2296 2297 The ability of an independent subexpression to prevent backtracking 2298 can be quite useful. Suppose we want to match a non-empty string 2299 enclosed in parentheses up to two levels deep. Then the following 2300 regexp matches: 2301 2302 $x = "abc(de(fg)h"; # unbalanced parentheses 2303 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x; 2304 2305 The regexp matches an open parenthesis, one or more copies of an 2306 alternation, and a close parenthesis. The alternation is two-way, with 2307 the first alternative C<[^()]+> matching a substring with no 2308 parentheses and the second alternative C<\([^()]*\)> matching a 2309 substring delimited by parentheses. The problem with this regexp is 2310 that it is pathological: it has nested indeterminate quantifiers 2311 of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers 2312 like this could take an exponentially long time to execute if there 2313 was no match possible. To prevent the exponential blowup, we need to 2314 prevent useless backtracking at some point. This can be done by 2315 enclosing the inner quantifier as an independent subexpression: 2316 2317 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x; 2318 2319 Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning 2320 by gobbling up as much of the string as possible and keeping it. Then 2321 match failures fail much more quickly. 2322 2323 2324 =head2 Conditional expressions 2325 2326 A I<conditional expression> is a form of if-then-else statement 2327 that allows one to choose which patterns are to be matched, based on 2328 some condition. There are two types of conditional expression: 2329 C<(?(condition)yes-regexp)> and 2330 C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is 2331 like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true, 2332 the C<yes-regexp> will be matched. If the C<condition> is false, the 2333 C<yes-regexp> will be skipped and Perl will move onto the next regexp 2334 element. The second form is like an S<C<'if () {} else {}'>> statement 2335 in Perl. If the C<condition> is true, the C<yes-regexp> will be 2336 matched, otherwise the C<no-regexp> will be matched. 2337 2338 The C<condition> can have several forms. The first form is simply an 2339 integer in parentheses C<(integer)>. It is true if the corresponding 2340 backreference C<\integer> matched earlier in the regexp. The same 2341 thing can be done with a name associated with a capture buffer, written 2342 as C<< (<name>) >> or C<< ('name') >>. The second form is a bare 2343 zero width assertion C<(?...)>, either a lookahead, a lookbehind, or a 2344 code assertion (discussed in the next section). The third set of forms 2345 provides tests that return true if the expression is executed within 2346 a recursion (C<(R)>) or is being called from some capturing group, 2347 referenced either by number (C<(R1)>, C<(R2)>,...) or by name 2348 (C<(R&name)>). 2349 2350 The integer or name form of the C<condition> allows us to choose, 2351 with more flexibility, what to match based on what matched earlier in the 2352 regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">: 2353 2354 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words 2355 beriberi 2356 coco 2357 couscous 2358 deed 2359 ... 2360 toot 2361 toto 2362 tutu 2363 2364 The lookbehind C<condition> allows, along with backreferences, 2365 an earlier part of the match to influence a later part of the 2366 match. For instance, 2367 2368 /[ATGC]+(?(?<=AA)G|C)$/; 2369 2370 matches a DNA sequence such that it either ends in C<AAG>, or some 2371 other base pair combination and C<C>. Note that the form is 2372 C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the 2373 lookahead, lookbehind or code assertions, the parentheses around the 2374 conditional are not needed. 2375 2376 2377 =head2 Defining named patterns 2378 2379 Some regular expressions use identical subpatterns in several places. 2380 Starting with Perl 5.10, it is possible to define named subpatterns in 2381 a section of the pattern so that they can be called up by name 2382 anywhere in the pattern. This syntactic pattern for this definition 2383 group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion 2384 of a named pattern is written as C<(?&name)>. 2385 2386 The example below illustrates this feature using the pattern for 2387 floating point numbers that was presented earlier on. The three 2388 subpatterns that are used more than once are the optional sign, the 2389 digit sequence for an integer and the decimal fraction. The DEFINE 2390 group at the end of the pattern contains their definition. Notice 2391 that the decimal fraction pattern is the first place where we can 2392 reuse the integer pattern. 2393 2394 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) ) 2395 (?: [eE](?&osg)(?&int) )? 2396 $ 2397 (?(DEFINE) 2398 (?<osg>[-+]?) # optional sign 2399 (?<int>\d++) # integer 2400 (?<dec>\.(?&int)) # decimal fraction 2401 )/x 2402 2403 2404 =head2 Recursive patterns 2405 2406 This feature (introduced in Perl 5.10) significantly extends the 2407 power of Perl's pattern matching. By referring to some other 2408 capture group anywhere in the pattern with the construct 2409 C<(?group-ref)>, the I<pattern> within the referenced group is used 2410 as an independent subpattern in place of the group reference itself. 2411 Because the group reference may be contained I<within> the group it 2412 refers to, it is now possible to apply pattern matching to tasks that 2413 hitherto required a recursive parser. 2414 2415 To illustrate this feature, we'll design a pattern that matches if 2416 a string contains a palindrome. (This is a word or a sentence that, 2417 while ignoring spaces, interpunctuation and case, reads the same backwards 2418 as forwards. We begin by observing that the empty string or a string 2419 containing just one word character is a palindrome. Otherwise it must 2420 have a word character up front and the same at its end, with another 2421 palindrome in between. 2422 2423 /(?: (\w) (?...Here be a palindrome...) \{-1} | \w? )/x 2424 2425 Adding C<\W*> at either end to eliminate was is to be ignored, we already 2426 have the full pattern: 2427 2428 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix; 2429 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){ 2430 print "'$s' is a palindrome\n" if $s =~ /$pp/; 2431 } 2432 2433 In C<(?...)> both absolute and relative backreferences may be used. 2434 The entire pattern can be reinserted with C<(?R)> or C<(?0)>. 2435 If you prefer to name your buffers, you can use C<(?&name)> to 2436 recurse into that buffer. 2437 2438 2439 =head2 A bit of magic: executing Perl code in a regular expression 2440 2441 Normally, regexps are a part of Perl expressions. 2442 I<Code evaluation> expressions turn that around by allowing 2443 arbitrary Perl code to be a part of a regexp. A code evaluation 2444 expression is denoted C<(?{code})>, with I<code> a string of Perl 2445 statements. 2446 2447 Be warned that this feature is considered experimental, and may be 2448 changed without notice. 2449 2450 Code expressions are zero-width assertions, and the value they return 2451 depends on their environment. There are two possibilities: either the 2452 code expression is used as a conditional in a conditional expression 2453 C<(?(condition)...)>, or it is not. If the code expression is a 2454 conditional, the code is evaluated and the result (i.e., the result of 2455 the last statement) is used to determine truth or falsehood. If the 2456 code expression is not used as a conditional, the assertion always 2457 evaluates true and the result is put into the special variable 2458 C<$^R>. The variable C<$^R> can then be used in code expressions later 2459 in the regexp. Here are some silly examples: 2460 2461 $x = "abcdef"; 2462 $x =~ /abc(?{print "Hi Mom!";})def/; # matches, 2463 # prints 'Hi Mom!' 2464 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match, 2465 # no 'Hi Mom!' 2466 2467 Pay careful attention to the next example: 2468 2469 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match, 2470 # no 'Hi Mom!' 2471 # but why not? 2472 2473 At first glance, you'd think that it shouldn't print, because obviously 2474 the C<ddd> isn't going to match the target string. But look at this 2475 example: 2476 2477 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match, 2478 # but _does_ print 2479 2480 Hmm. What happened here? If you've been following along, you know that 2481 the above pattern should be effectively the same as the last one -- 2482 enclosing the d in a character class isn't going to change what it 2483 matches. So why does the first not print while the second one does? 2484 2485 The answer lies in the optimizations the regex engine makes. In the first 2486 case, all the engine sees are plain old characters (aside from the 2487 C<?{}> construct). It's smart enough to realize that the string 'ddd' 2488 doesn't occur in our target string before actually running the pattern 2489 through. But in the second case, we've tricked it into thinking that our 2490 pattern is more complicated than it is. It takes a look, sees our 2491 character class, and decides that it will have to actually run the 2492 pattern to determine whether or not it matches, and in the process of 2493 running it hits the print statement before it discovers that we don't 2494 have a match. 2495 2496 To take a closer look at how the engine does optimizations, see the 2497 section L<"Pragmas and debugging"> below. 2498 2499 More fun with C<?{}>: 2500 2501 $x =~ /(?{print "Hi Mom!";})/; # matches, 2502 # prints 'Hi Mom!' 2503 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches, 2504 # prints '1' 2505 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches, 2506 # prints '1' 2507 2508 The bit of magic mentioned in the section title occurs when the regexp 2509 backtracks in the process of searching for a match. If the regexp 2510 backtracks over a code expression and if the variables used within are 2511 localized using C<local>, the changes in the variables produced by the 2512 code expression are undone! Thus, if we wanted to count how many times 2513 a character got matched inside a group, we could use, e.g., 2514 2515 $x = "aaaa"; 2516 $count = 0; # initialize 'a' count 2517 $c = "bob"; # test if $c gets clobbered 2518 $x =~ /(?{local $c = 0;}) # initialize count 2519 ( a # match 'a' 2520 (?{local $c = $c + 1;}) # increment count 2521 )* # do this any number of times, 2522 aa # but match 'aa' at the end 2523 (?{$count = $c;}) # copy local $c var into $count 2524 /x; 2525 print "'a' count is $count, \$c variable is '$c'\n"; 2526 2527 This prints 2528 2529 'a' count is 2, $c variable is 'bob' 2530 2531 If we replace the S<C< (?{local $c = $c + 1;})>> with 2532 S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone 2533 during backtracking, and we get 2534 2535 'a' count is 4, $c variable is 'bob' 2536 2537 Note that only localized variable changes are undone. Other side 2538 effects of code expression execution are permanent. Thus 2539 2540 $x = "aaaa"; 2541 $x =~ /(a(?{print "Yow\n";}))*aa/; 2542 2543 produces 2544 2545 Yow 2546 Yow 2547 Yow 2548 Yow 2549 2550 The result C<$^R> is automatically localized, so that it will behave 2551 properly in the presence of backtracking. 2552 2553 This example uses a code expression in a conditional to match a 2554 definite article, either 'the' in English or 'der|die|das' in German: 2555 2556 $lang = 'DE'; # use German 2557 ... 2558 $text = "das"; 2559 print "matched\n" 2560 if $text =~ /(?(?{ 2561 $lang eq 'EN'; # is the language English? 2562 }) 2563 the | # if so, then match 'the' 2564 (der|die|das) # else, match 'der|die|das' 2565 ) 2566 /xi; 2567 2568 Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not 2569 C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a 2570 code expression, we don't need the extra parentheses around the 2571 conditional. 2572 2573 If you try to use code expressions with interpolating variables, Perl 2574 may surprise you: 2575 2576 $bar = 5; 2577 $pat = '(?{ 1 })'; 2578 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated 2579 /foo(?{ 1 })$bar/; # compile error! 2580 /foo$pat}bar/; # compile error! 2581 2582 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp 2583 /foo$pat}bar/; # compiles ok 2584 2585 If a regexp has (1) code expressions and interpolating variables, or 2586 (2) a variable that interpolates a code expression, Perl treats the 2587 regexp as an error. If the code expression is precompiled into a 2588 variable, however, interpolating is ok. The question is, why is this 2589 an error? 2590 2591 The reason is that variable interpolation and code expressions 2592 together pose a security risk. The combination is dangerous because 2593 many programmers who write search engines often take user input and 2594 plug it directly into a regexp: 2595 2596 $regexp = <>; # read user-supplied regexp 2597 $chomp $regexp; # get rid of possible newline 2598 $text =~ /$regexp/; # search $text for the $regexp 2599 2600 If the C<$regexp> variable contains a code expression, the user could 2601 then execute arbitrary Perl code. For instance, some joker could 2602 search for S<C<system('rm -rf *');>> to erase your files. In this 2603 sense, the combination of interpolation and code expressions I<taints> 2604 your regexp. So by default, using both interpolation and code 2605 expressions in the same regexp is not allowed. If you're not 2606 concerned about malicious users, it is possible to bypass this 2607 security check by invoking S<C<use re 'eval'>>: 2608 2609 use re 'eval'; # throw caution out the door 2610 $bar = 5; 2611 $pat = '(?{ 1 })'; 2612 /foo(?{ 1 })$bar/; # compiles ok 2613 /foo$pat}bar/; # compiles ok 2614 2615 Another form of code expression is the I<pattern code expression>. 2616 The pattern code expression is like a regular code expression, except 2617 that the result of the code evaluation is treated as a regular 2618 expression and matched immediately. A simple example is 2619 2620 $length = 5; 2621 $char = 'a'; 2622 $x = 'aaaaabb'; 2623 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a' 2624 2625 2626 This final example contains both ordinary and pattern code 2627 expressions. It detects whether a binary string C<1101010010001...> has a 2628 Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s: 2629 2630 $x = "1101010010001000001"; 2631 $z0 = ''; $z1 = '0'; # initial conditions 2632 print "It is a Fibonacci sequence\n" 2633 if $x =~ /^1 # match an initial '1' 2634 (?: 2635 ((??{ $z0 })) # match some '0' 2636 1 # and then a '1' 2637 (?{ $z0 = $z1; $z1 .= $^N; }) 2638 )+ # repeat as needed 2639 $ # that is all there is 2640 /x; 2641 printf "Largest sequence matched was %d\n", length($z1)-length($z0); 2642 2643 Remember that C<$^N> is set to whatever was matched by the last 2644 completed capture group. This prints 2645 2646 It is a Fibonacci sequence 2647 Largest sequence matched was 5 2648 2649 Ha! Try that with your garden variety regexp package... 2650 2651 Note that the variables C<$z0> and C<$z1> are not substituted when the 2652 regexp is compiled, as happens for ordinary variables outside a code 2653 expression. Rather, the code expressions are evaluated when Perl 2654 encounters them during the search for a match. 2655 2656 The regexp without the C<//x> modifier is 2657 2658 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/ 2659 2660 which shows that spaces are still possible in the code parts. Nevertheless, 2661 when working with code and conditional expressions, the extended form of 2662 regexps is almost necessary in creating and debugging regexps. 2663 2664 2665 =head2 Backtracking control verbs 2666 2667 Perl 5.10 introduced a number of control verbs intended to provide 2668 detailed control over the backtracking process, by directly influencing 2669 the regexp engine and by providing monitoring techniques. As all 2670 the features in this group are experimental and subject to change or 2671 removal in a future version of Perl, the interested reader is 2672 referred to L<perlre/"Special Backtracking Control Verbs"> for a 2673 detailed description. 2674 2675 Below is just one example, illustrating the control verb C<(*FAIL)>, 2676 which may be abbreviated as C<(*F)>. If this is inserted in a regexp 2677 it will cause to fail, just like at some mismatch between the pattern 2678 and the string. Processing of the regexp continues like after any "normal" 2679 failure, so that, for instance, the next position in the string or another 2680 alternative will be tried. As failing to match doesn't preserve capture 2681 buffers or produce results, it may be necessary to use this in 2682 combination with embedded code. 2683 2684 %count = (); 2685 "supercalifragilisticexpialidoceous" =~ 2686 /([aeiou])(?{ $count{$1}++; })(*FAIL)/oi; 2687 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count); 2688 2689 The pattern begins with a class matching a subset of letters. Whenever 2690 this matches, a statement like C<$count{'a'}++;> is executed, incrementing 2691 the letter's counter. Then C<(*FAIL)> does what it says, and 2692 the regexp engine proceeds according to the book: as long as the end of 2693 the string hasn't been reached, the position is advanced before looking 2694 for another vowel. Thus, match or no match makes no difference, and the 2695 regexp engine proceeds until the the entire string has been inspected. 2696 (It's remarkable that an alternative solution using something like 2697 2698 $count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous"); 2699 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } ); 2700 2701 is considerably slower.) 2702 2703 2704 =head2 Pragmas and debugging 2705 2706 Speaking of debugging, there are several pragmas available to control 2707 and debug regexps in Perl. We have already encountered one pragma in 2708 the previous section, S<C<use re 'eval';>>, that allows variable 2709 interpolation and code expressions to coexist in a regexp. The other 2710 pragmas are 2711 2712 use re 'taint'; 2713 $tainted = <>; 2714 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted 2715 2716 The C<taint> pragma causes any substrings from a match with a tainted 2717 variable to be tainted as well. This is not normally the case, as 2718 regexps are often used to extract the safe bits from a tainted 2719 variable. Use C<taint> when you are not extracting safe bits, but are 2720 performing some other processing. Both C<taint> and C<eval> pragmas 2721 are lexically scoped, which means they are in effect only until 2722 the end of the block enclosing the pragmas. 2723 2724 use re 'debug'; 2725 /^(.*)$/s; # output debugging info 2726 2727 use re 'debugcolor'; 2728 /^(.*)$/s; # output debugging info in living color 2729 2730 The global C<debug> and C<debugcolor> pragmas allow one to get 2731 detailed debugging info about regexp compilation and 2732 execution. C<debugcolor> is the same as debug, except the debugging 2733 information is displayed in color on terminals that can display 2734 termcap color sequences. Here is example output: 2735 2736 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;' 2737 Compiling REx `a*b+c' 2738 size 9 first at 1 2739 1: STAR(4) 2740 2: EXACT <a>(0) 2741 4: PLUS(7) 2742 5: EXACT <b>(0) 2743 7: EXACT <c>(9) 2744 9: END(0) 2745 floating `bc' at 0..2147483647 (checking floating) minlen 2 2746 Guessing start of match, REx `a*b+c' against `abc'... 2747 Found floating substr `bc' at offset 1... 2748 Guessed: match at offset 0 2749 Matching REx `a*b+c' against `abc' 2750 Setting an EVAL scope, savestack=3 2751 0 <> <abc> | 1: STAR 2752 EXACT <a> can match 1 times out of 32767... 2753 Setting an EVAL scope, savestack=3 2754 1 <a> <bc> | 4: PLUS 2755 EXACT <b> can match 1 times out of 32767... 2756 Setting an EVAL scope, savestack=3 2757 2 <ab> <c> | 7: EXACT <c> 2758 3 <abc> <> | 9: END 2759 Match successful! 2760 Freeing REx: `a*b+c' 2761 2762 If you have gotten this far into the tutorial, you can probably guess 2763 what the different parts of the debugging output tell you. The first 2764 part 2765 2766 Compiling REx `a*b+c' 2767 size 9 first at 1 2768 1: STAR(4) 2769 2: EXACT <a>(0) 2770 4: PLUS(7) 2771 5: EXACT <b>(0) 2772 7: EXACT <c>(9) 2773 9: END(0) 2774 2775 describes the compilation stage. C<STAR(4)> means that there is a 2776 starred object, in this case C<'a'>, and if it matches, goto line 4, 2777 i.e., C<PLUS(7)>. The middle lines describe some heuristics and 2778 optimizations performed before a match: 2779 2780 floating `bc' at 0..2147483647 (checking floating) minlen 2 2781 Guessing start of match, REx `a*b+c' against `abc'... 2782 Found floating substr `bc' at offset 1... 2783 Guessed: match at offset 0 2784 2785 Then the match is executed and the remaining lines describe the 2786 process: 2787 2788 Matching REx `a*b+c' against `abc' 2789 Setting an EVAL scope, savestack=3 2790 0 <> <abc> | 1: STAR 2791 EXACT <a> can match 1 times out of 32767... 2792 Setting an EVAL scope, savestack=3 2793 1 <a> <bc> | 4: PLUS 2794 EXACT <b> can match 1 times out of 32767... 2795 Setting an EVAL scope, savestack=3 2796 2 <ab> <c> | 7: EXACT <c> 2797 3 <abc> <> | 9: END 2798 Match successful! 2799 Freeing REx: `a*b+c' 2800 2801 Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the 2802 part of the string matched and C<< <y> >> the part not yet 2803 matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1 2804 n the compilation list above. See 2805 L<perldebguts/"Debugging regular expressions"> for much more detail. 2806 2807 An alternative method of debugging regexps is to embed C<print> 2808 statements within the regexp. This provides a blow-by-blow account of 2809 the backtracking in an alternation: 2810 2811 "that this" =~ m@(?{print "Start at position ", pos, "\n";}) 2812 t(?{print "t1\n";}) 2813 h(?{print "h1\n";}) 2814 i(?{print "i1\n";}) 2815 s(?{print "s1\n";}) 2816 | 2817 t(?{print "t2\n";}) 2818 h(?{print "h2\n";}) 2819 a(?{print "a2\n";}) 2820 t(?{print "t2\n";}) 2821 (?{print "Done at position ", pos, "\n";}) 2822 @x; 2823 2824 prints 2825 2826 Start at position 0 2827 t1 2828 h1 2829 t2 2830 h2 2831 a2 2832 t2 2833 Done at position 4 2834 2835 =head1 BUGS 2836 2837 Code expressions, conditional expressions, and independent expressions 2838 are I<experimental>. Don't use them in production code. Yet. 2839 2840 =head1 SEE ALSO 2841 2842 This is just a tutorial. For the full story on Perl regular 2843 expressions, see the L<perlre> regular expressions reference page. 2844 2845 For more information on the matching C<m//> and substitution C<s///> 2846 operators, see L<perlop/"Regexp Quote-Like Operators">. For 2847 information on the C<split> operation, see L<perlfunc/split>. 2848 2849 For an excellent all-around resource on the care and feeding of 2850 regular expressions, see the book I<Mastering Regular Expressions> by 2851 Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3). 2852 2853 =head1 AUTHOR AND COPYRIGHT 2854 2855 Copyright (c) 2000 Mark Kvale 2856 All rights reserved. 2857 2858 This document may be distributed under the same terms as Perl itself. 2859 2860 =head2 Acknowledgments 2861 2862 The inspiration for the stop codon DNA example came from the ZIP 2863 code example in chapter 7 of I<Mastering Regular Expressions>. 2864 2865 The author would like to thank Jeff Pinyan, Andrew Johnson, Peter 2866 Haworth, Ronald J Kimball, and Joe Smith for all their helpful 2867 comments. 2868 2869 =cut 2870
title
Description
Body
title
Description
Body
title
Description
Body
title
Body
| Generated: Tue Mar 17 22:47:18 2015 | Cross-referenced by PHPXref 0.7.1 |